SimRNA (c) 2009-2024 Genesilico, ver. 3.33 Replica Exchange Monte Carlo Method is SWITCHED ON 10 replicas were ordered .reading parameteres setting random seed = 1 initiating replica nr: 1 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.900 successfully initiated initiating replica nr: 2 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 0.950 successfully initiated initiating replica nr: 3 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.000 successfully initiated initiating replica nr: 4 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.050 successfully initiated initiating replica nr: 5 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.100 successfully initiated initiating replica nr: 6 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.150 successfully initiated initiating replica nr: 7 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.200 successfully initiated initiating replica nr: 8 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.250 successfully initiated initiating replica nr: 9 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.300 successfully initiated initiating replica nr: 10 before entireStruct->initialize(input) file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa first_line: R number of RNA chain(s) decalred/expected in file: /home/simrnaweb/SimRNAWeb/SIMULATIONS/1-0237fbe0/inputs/seq.fa: 1 curr_seq: _AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU_ chainIds_rna: _A_, chainIds_protein: __ chainId: A, chainSeq: AACGUCUGAUCUGUGGGGCGAGGGGCCCGCGAGUGCGGU RNAStructure(struct InputParam): Fraction Of One Atom Moves = 0.450000 RNAStructure(struct InputParam): Fraction Of Two Atoms Moves = 0.440000 RNAStructure(struct InputParam): Fraction Of Fragment Moves = 0.010000 RNAStructure(struct InputParam): Fraction Of Nitrogen Atom Moves = 0.100000 RNAStructure(struct InputParam): Fraction Of Rigid Rotation Moves = 0.000000 RNAStructure(struct InputParam): Fraction Of Rigid Translation Moves = 0.000000 RNA chains: chain A contains 39 nucleotides loading histrogram: ./data/rna/dist_PC.data.new_hist assigned_name: dist_PC.data.new_hist DONE loading histrogram: ./data/rna/dist_CP.data.new_hist assigned_name: dist_CP.data.new_hist DONE loading histrogram: ./data/rna/angle_PCP.data.new_hist assigned_name: angle_PCP.data.new_hist DONE loading histrogram: ./data/rna/angle_CPC.data.new_hist assigned_name: angle_CPC.data.new_hist DONE loading histrogram: ./data/rna/eta_theta.data.new_hist assigned_name: eta_theta.data.new_hist DONE reweighting term eta_theta by 0.400000, default value scaling: histogram eta_theta.data.new_hist was multiplied by 0.400000 eta-theta term was reweighted by factor 0.400000 provided by the user reading conformers file: ./data/rna/A_conformers n_lines: 4766 16 15 69 34 27 46 26 156 83 35 93 127 1269 89 50 187 157 1927 88 75 51 22 67 25 32 DONE reading conformers file: ./data/rna/C_conformers n_lines: 5164 7 8 61 17 4 14 12 143 49 12 23 140 2110 21 24 88 101 2101 19 36 25 21 108 8 12 DONE reading conformers file: ./data/rna/G_conformers n_lines: 6375 11 7 79 21 50 20 17 175 54 39 42 102 2774 90 34 61 94 2314 71 100 20 22 142 15 21 DONE reading conformers file: ./data/rna/U_conformers n_lines: 3617 6 6 43 33 24 20 20 131 50 28 30 58 1412 30 24 64 82 1197 31 32 71 36 132 13 44 DONE loading histrogram: ./data/rna/AA3.hist assigned_name: AA3.hist DONE loading histrogram: ./data/rna/AC3.hist assigned_name: AC3.hist DONE loading histrogram: ./data/rna/AG3.hist assigned_name: AG3.hist DONE loading histrogram: ./data/rna/AU3.hist assigned_name: AU3.hist DONE loading histrogram: ./data/rna/CA3.hist assigned_name: CA3.hist DONE loading histrogram: ./data/rna/CC3.hist assigned_name: CC3.hist DONE loading histrogram: ./data/rna/CG3.hist assigned_name: CG3.hist DONE loading histrogram: ./data/rna/CU3.hist assigned_name: CU3.hist DONE loading histrogram: ./data/rna/GA3.hist assigned_name: GA3.hist DONE loading histrogram: ./data/rna/GC3.hist assigned_name: GC3.hist DONE loading histrogram: ./data/rna/GG3.hist assigned_name: GG3.hist DONE loading histrogram: ./data/rna/GU3.hist assigned_name: GU3.hist DONE loading histrogram: ./data/rna/UA3.hist assigned_name: UA3.hist DONE loading histrogram: ./data/rna/UC3.hist assigned_name: UC3.hist DONE loading histrogram: ./data/rna/UG3.hist assigned_name: UG3.hist DONE loading histrogram: ./data/rna/UU3.hist assigned_name: UU3.hist DONE loading histrogram: ./data/rna/AU3_WW-repulsive.hist assigned_name: AU3_WW-repulsive.hist DONE scaling: histogram AU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/CG3_WW-repulsive.hist assigned_name: CG3_WW-repulsive.hist DONE scaling: histogram CG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GC3_WW-repulsive.hist assigned_name: GC3_WW-repulsive.hist DONE scaling: histogram GC3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/GU3_WW-repulsive.hist assigned_name: GU3_WW-repulsive.hist DONE scaling: histogram GU3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UA3_WW-repulsive.hist assigned_name: UA3_WW-repulsive.hist DONE scaling: histogram UA3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/UG3_WW-repulsive.hist assigned_name: UG3_WW-repulsive.hist DONE scaling: histogram UG3_WW-repulsive.hist was multiplied by -1.000000 loading histrogram: ./data/rna/A-C4_3.hist assigned_name: A-C4_3.hist DONE loading histrogram: ./data/rna/C-C4_3.hist assigned_name: C-C4_3.hist DONE loading histrogram: ./data/rna/G-C4_3.hist assigned_name: G-C4_3.hist DONE loading histrogram: ./data/rna/U-C4_3.hist assigned_name: U-C4_3.hist DONE loading histrogram: ./data/rna/A-P_3.hist assigned_name: A-P_3.hist DONE loading histrogram: ./data/rna/C-P_3.hist assigned_name: C-P_3.hist DONE loading histrogram: ./data/rna/G-P_3.hist assigned_name: G-P_3.hist DONE loading histrogram: ./data/rna/U-P_3.hist assigned_name: U-P_3.hist DONE loading histrogram: ./data/rna/A_3_exvol.hist assigned_name: A_3_exvol.hist DONE scaling: histogram A_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/C_3_exvol.hist assigned_name: C_3_exvol.hist DONE scaling: histogram C_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/G_3_exvol.hist assigned_name: G_3_exvol.hist DONE scaling: histogram G_3_exvol.hist was multiplied by 0.100000 loading histrogram: ./data/rna/U_3_exvol.hist assigned_name: U_3_exvol.hist DONE scaling: histogram U_3_exvol.hist was multiplied by 0.100000 x_protein_frc: 0.000 x_rna_frc: 1.000 int EntireStructure::calcNumberOfAtoms(): numberOfAtoms: 200 n_atoms_counter: 200 Fraction Of RNA Moves = 1.000000 Fraction Of Protein Moves = 0.000000 EntireStructure::rnaStruct limitingSphereRadius : 39.000000 DONE before calcCenterOfMass(); after calcCenterOfMass(); before calcTotalEnergy(); after calcTotalEnergy(); after entireStruct->initialize(input) leaving: void SimulatedAnnealing::chooseTypeOfChain(struct InputParam input) number of iterations = 1600000 trajectory write in every 16000 iterations after each trajectory write attempt of changing replicas will be done replica Temperature = 1.350 successfully initiated .calculating program compiled for parallel execution of replicas in Replica Exchange MC method program can utilize maximum as many CPU cores as replicas, in this case: 10 ================================== temp. level: 1, replica: 1 ===================================== Write number: 1 Temperature: 0.900000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 1 Temperature: 0.950000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 1 Temperature: 1.000000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 1 Temperature: 1.050000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 1 Temperature: 1.100000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 1 Temperature: 1.150000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 1 Temperature: 1.200000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 1 Temperature: 1.250000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 1 Temperature: 1.300000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 1 Temperature: 1.350000 Total energy: -156.629654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -156.629654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -156.629654 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -152.155527 where: bonds (distance) C4'-P energy: -37.892 bonds (distance) P-C4' energy: -35.786 flat angles C4'-P-C4' energy: -28.635 flat angles P-C4'-P energy: -32.755 tors. eta vs tors. theta energy: -17.088 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 2 Temperature: 0.900000 Total energy: -251.712777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.712777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.712777 (E_RNA) where: Base-Base interactions energy: -128.713 where: short stacking energy: -113.383 Base-Backbone interact. energy: 1.022 local terms energy: -124.022406 where: bonds (distance) C4'-P energy: -29.543 bonds (distance) P-C4' energy: -29.445 flat angles C4'-P-C4' energy: -24.193 flat angles P-C4'-P energy: -16.667 tors. eta vs tors. theta energy: -24.175 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 2 Temperature: 0.950000 Total energy: -214.341774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.341774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.341774 (E_RNA) where: Base-Base interactions energy: -101.355 where: short stacking energy: -95.612 Base-Backbone interact. energy: -0.168 local terms energy: -112.818436 where: bonds (distance) C4'-P energy: -30.022 bonds (distance) P-C4' energy: -25.350 flat angles C4'-P-C4' energy: -23.564 flat angles P-C4'-P energy: -12.357 tors. eta vs tors. theta energy: -21.525 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 2 Temperature: 1.000000 Total energy: -258.865686 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.865686 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.865686 (E_RNA) where: Base-Base interactions energy: -144.600 where: short stacking energy: -111.663 Base-Backbone interact. energy: -0.118 local terms energy: -114.147429 where: bonds (distance) C4'-P energy: -25.920 bonds (distance) P-C4' energy: -27.512 flat angles C4'-P-C4' energy: -19.939 flat angles P-C4'-P energy: -19.145 tors. eta vs tors. theta energy: -21.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 2 Temperature: 1.050000 Total energy: -188.898001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -188.898001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -188.898001 (E_RNA) where: Base-Base interactions energy: -86.374 where: short stacking energy: -86.674 Base-Backbone interact. energy: -0.159 local terms energy: -102.364748 where: bonds (distance) C4'-P energy: -29.398 bonds (distance) P-C4' energy: -23.292 flat angles C4'-P-C4' energy: -14.587 flat angles P-C4'-P energy: -16.694 tors. eta vs tors. theta energy: -18.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 2 Temperature: 1.100000 Total energy: -207.512454 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.512454 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.512454 (E_RNA) where: Base-Base interactions energy: -107.787 where: short stacking energy: -84.274 Base-Backbone interact. energy: -0.966 local terms energy: -98.759870 where: bonds (distance) C4'-P energy: -19.326 bonds (distance) P-C4' energy: -25.007 flat angles C4'-P-C4' energy: -20.802 flat angles P-C4'-P energy: -17.127 tors. eta vs tors. theta energy: -16.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 2 Temperature: 1.150000 Total energy: -215.918482 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.918482 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.918482 (E_RNA) where: Base-Base interactions energy: -119.753 where: short stacking energy: -72.065 Base-Backbone interact. energy: -0.188 local terms energy: -95.977082 where: bonds (distance) C4'-P energy: -18.866 bonds (distance) P-C4' energy: -20.449 flat angles C4'-P-C4' energy: -29.216 flat angles P-C4'-P energy: -14.869 tors. eta vs tors. theta energy: -12.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 2 Temperature: 1.200000 Total energy: -172.734626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -172.734626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -172.734626 (E_RNA) where: Base-Base interactions energy: -79.587 where: short stacking energy: -55.158 Base-Backbone interact. energy: 0.044 local terms energy: -93.191612 where: bonds (distance) C4'-P energy: -27.873 bonds (distance) P-C4' energy: -24.029 flat angles C4'-P-C4' energy: -20.470 flat angles P-C4'-P energy: -18.407 tors. eta vs tors. theta energy: -2.413 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 2 Temperature: 1.250000 Total energy: -155.497009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.497009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.497009 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -151.022881 where: bonds (distance) C4'-P energy: -37.776 bonds (distance) P-C4' energy: -35.779 flat angles C4'-P-C4' energy: -28.050 flat angles P-C4'-P energy: -32.681 tors. eta vs tors. theta energy: -16.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 2 Temperature: 1.300000 Total energy: -157.723512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.723512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.723512 (E_RNA) where: Base-Base interactions energy: -65.288 where: short stacking energy: -63.729 Base-Backbone interact. energy: -0.147 local terms energy: -92.288790 where: bonds (distance) C4'-P energy: -20.130 bonds (distance) P-C4' energy: -26.081 flat angles C4'-P-C4' energy: -22.758 flat angles P-C4'-P energy: -10.035 tors. eta vs tors. theta energy: -13.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 2 Temperature: 1.350000 Total energy: -155.534251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -155.534251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -155.534251 (E_RNA) where: Base-Base interactions energy: -4.474 where: short stacking energy: -4.474 Base-Backbone interact. energy: -0.000 local terms energy: -151.060123 where: bonds (distance) C4'-P energy: -37.776 bonds (distance) P-C4' energy: -35.779 flat angles C4'-P-C4' energy: -28.050 flat angles P-C4'-P energy: -32.718 tors. eta vs tors. theta energy: -16.738 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 3 Temperature: 0.900000 Total energy: -310.833267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.833267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.833267 (E_RNA) where: Base-Base interactions energy: -190.547 where: short stacking energy: -113.462 Base-Backbone interact. energy: -0.520 local terms energy: -119.766431 where: bonds (distance) C4'-P energy: -29.105 bonds (distance) P-C4' energy: -24.901 flat angles C4'-P-C4' energy: -17.701 flat angles P-C4'-P energy: -22.805 tors. eta vs tors. theta energy: -25.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 3 Temperature: 0.950000 Total energy: -301.322474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -301.322474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -301.322474 (E_RNA) where: Base-Base interactions energy: -175.942 where: short stacking energy: -103.849 Base-Backbone interact. energy: -0.014 local terms energy: -125.366232 where: bonds (distance) C4'-P energy: -28.784 bonds (distance) P-C4' energy: -27.441 flat angles C4'-P-C4' energy: -30.521 flat angles P-C4'-P energy: -16.547 tors. eta vs tors. theta energy: -22.073 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 3 Temperature: 1.000000 Total energy: -264.027526 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.027526 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.027526 (E_RNA) where: Base-Base interactions energy: -150.387 where: short stacking energy: -100.830 Base-Backbone interact. energy: -0.131 local terms energy: -113.509225 where: bonds (distance) C4'-P energy: -24.284 bonds (distance) P-C4' energy: -26.697 flat angles C4'-P-C4' energy: -25.666 flat angles P-C4'-P energy: -13.101 tors. eta vs tors. theta energy: -23.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 3 Temperature: 1.050000 Total energy: -239.827210 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.827210 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.827210 (E_RNA) where: Base-Base interactions energy: -125.682 where: short stacking energy: -86.914 Base-Backbone interact. energy: 1.121 local terms energy: -115.266635 where: bonds (distance) C4'-P energy: -27.845 bonds (distance) P-C4' energy: -25.009 flat angles C4'-P-C4' energy: -28.147 flat angles P-C4'-P energy: -18.738 tors. eta vs tors. theta energy: -15.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 3 Temperature: 1.100000 Total energy: -202.265851 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -202.265851 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -202.265851 (E_RNA) where: Base-Base interactions energy: -103.986 where: short stacking energy: -72.800 Base-Backbone interact. energy: -0.336 local terms energy: -97.943321 where: bonds (distance) C4'-P energy: -15.922 bonds (distance) P-C4' energy: -29.691 flat angles C4'-P-C4' energy: -26.437 flat angles P-C4'-P energy: -13.328 tors. eta vs tors. theta energy: -12.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 3 Temperature: 1.150000 Total energy: -288.212390 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.212390 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.212390 (E_RNA) where: Base-Base interactions energy: -189.779 where: short stacking energy: -78.541 Base-Backbone interact. energy: 0.737 local terms energy: -99.170796 where: bonds (distance) C4'-P energy: -20.022 bonds (distance) P-C4' energy: -28.919 flat angles C4'-P-C4' energy: -23.633 flat angles P-C4'-P energy: -12.409 tors. eta vs tors. theta energy: -14.188 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 3 Temperature: 1.200000 Total energy: -210.362617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.362617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.362617 (E_RNA) where: Base-Base interactions energy: -118.380 where: short stacking energy: -60.898 Base-Backbone interact. energy: 1.500 local terms energy: -93.482017 where: bonds (distance) C4'-P energy: -22.385 bonds (distance) P-C4' energy: -29.034 flat angles C4'-P-C4' energy: -22.163 flat angles P-C4'-P energy: -10.545 tors. eta vs tors. theta energy: -9.355 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 3 Temperature: 1.250000 Total energy: -216.083362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.083362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.083362 (E_RNA) where: Base-Base interactions energy: -117.890 where: short stacking energy: -60.535 Base-Backbone interact. energy: -0.343 local terms energy: -97.850519 where: bonds (distance) C4'-P energy: -21.463 bonds (distance) P-C4' energy: -23.940 flat angles C4'-P-C4' energy: -28.523 flat angles P-C4'-P energy: -19.046 tors. eta vs tors. theta energy: -4.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 3 Temperature: 1.300000 Total energy: -217.902280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.902280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.902280 (E_RNA) where: Base-Base interactions energy: -130.129 where: short stacking energy: -69.223 Base-Backbone interact. energy: -0.575 local terms energy: -87.198926 where: bonds (distance) C4'-P energy: -20.094 bonds (distance) P-C4' energy: -24.027 flat angles C4'-P-C4' energy: -15.650 flat angles P-C4'-P energy: -18.673 tors. eta vs tors. theta energy: -8.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 3 Temperature: 1.350000 Total energy: -144.255197 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -144.255197 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -144.255197 (E_RNA) where: Base-Base interactions energy: -61.820 where: short stacking energy: -48.496 Base-Backbone interact. energy: -0.274 local terms energy: -82.160770 where: bonds (distance) C4'-P energy: -26.147 bonds (distance) P-C4' energy: -23.727 flat angles C4'-P-C4' energy: -22.533 flat angles P-C4'-P energy: -5.563 tors. eta vs tors. theta energy: -4.191 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 4 Temperature: 0.900000 Total energy: -312.182985 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -312.182985 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -312.182985 (E_RNA) where: Base-Base interactions energy: -194.525 where: short stacking energy: -114.305 Base-Backbone interact. energy: -0.347 local terms energy: -117.311648 where: bonds (distance) C4'-P energy: -28.244 bonds (distance) P-C4' energy: -21.971 flat angles C4'-P-C4' energy: -27.013 flat angles P-C4'-P energy: -17.458 tors. eta vs tors. theta energy: -22.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 4 Temperature: 0.950000 Total energy: -315.388177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.388177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.388177 (E_RNA) where: Base-Base interactions energy: -199.266 where: short stacking energy: -117.595 Base-Backbone interact. energy: 1.766 local terms energy: -117.887666 where: bonds (distance) C4'-P energy: -26.466 bonds (distance) P-C4' energy: -26.684 flat angles C4'-P-C4' energy: -27.017 flat angles P-C4'-P energy: -15.804 tors. eta vs tors. theta energy: -21.916 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 4 Temperature: 1.000000 Total energy: -284.264674 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.264674 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.264674 (E_RNA) where: Base-Base interactions energy: -173.055 where: short stacking energy: -104.829 Base-Backbone interact. energy: -0.417 local terms energy: -110.792917 where: bonds (distance) C4'-P energy: -23.271 bonds (distance) P-C4' energy: -25.046 flat angles C4'-P-C4' energy: -23.383 flat angles P-C4'-P energy: -11.830 tors. eta vs tors. theta energy: -27.264 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 5 ===================================== Write number: 4 Temperature: 1.050000 Total energy: -247.311514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.311514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.311514 (E_RNA) where: Base-Base interactions energy: -141.491 where: short stacking energy: -90.303 Base-Backbone interact. energy: -0.048 local terms energy: -105.772283 where: bonds (distance) C4'-P energy: -24.395 bonds (distance) P-C4' energy: -16.681 flat angles C4'-P-C4' energy: -28.869 flat angles P-C4'-P energy: -19.854 tors. eta vs tors. theta energy: -15.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 4 Temperature: 1.100000 Total energy: -320.578817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.578817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.578817 (E_RNA) where: Base-Base interactions energy: -204.431 where: short stacking energy: -98.076 Base-Backbone interact. energy: -0.098 local terms energy: -116.050090 where: bonds (distance) C4'-P energy: -24.193 bonds (distance) P-C4' energy: -25.582 flat angles C4'-P-C4' energy: -20.507 flat angles P-C4'-P energy: -19.634 tors. eta vs tors. theta energy: -26.134 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 4 Temperature: 1.150000 Total energy: -171.200605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -171.200605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -171.200605 (E_RNA) where: Base-Base interactions energy: -71.985 where: short stacking energy: -61.345 Base-Backbone interact. energy: -1.494 local terms energy: -97.721558 where: bonds (distance) C4'-P energy: -20.786 bonds (distance) P-C4' energy: -21.949 flat angles C4'-P-C4' energy: -24.503 flat angles P-C4'-P energy: -21.096 tors. eta vs tors. theta energy: -9.388 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 7 ===================================== Write number: 4 Temperature: 1.200000 Total energy: -247.344272 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.344272 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.344272 (E_RNA) where: Base-Base interactions energy: -144.789 where: short stacking energy: -62.754 Base-Backbone interact. energy: -0.464 local terms energy: -102.091268 where: bonds (distance) C4'-P energy: -32.001 bonds (distance) P-C4' energy: -27.719 flat angles C4'-P-C4' energy: -18.770 flat angles P-C4'-P energy: -18.934 tors. eta vs tors. theta energy: -4.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 4 Temperature: 1.250000 Total energy: -244.675534 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.675534 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.675534 (E_RNA) where: Base-Base interactions energy: -157.745 where: short stacking energy: -83.098 Base-Backbone interact. energy: 0.890 local terms energy: -87.820362 where: bonds (distance) C4'-P energy: -21.693 bonds (distance) P-C4' energy: -12.842 flat angles C4'-P-C4' energy: -20.540 flat angles P-C4'-P energy: -18.392 tors. eta vs tors. theta energy: -14.353 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 4 Temperature: 1.300000 Total energy: -220.894673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.894673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.894673 (E_RNA) where: Base-Base interactions energy: -133.802 where: short stacking energy: -52.296 Base-Backbone interact. energy: 0.017 local terms energy: -87.110070 where: bonds (distance) C4'-P energy: -23.903 bonds (distance) P-C4' energy: -27.086 flat angles C4'-P-C4' energy: -23.221 flat angles P-C4'-P energy: -15.061 tors. eta vs tors. theta energy: 2.161 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 4 Temperature: 1.350000 Total energy: -146.446968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.446968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.446968 (E_RNA) where: Base-Base interactions energy: -56.624 where: short stacking energy: -47.852 Base-Backbone interact. energy: -0.252 local terms energy: -89.571054 where: bonds (distance) C4'-P energy: -24.621 bonds (distance) P-C4' energy: -19.208 flat angles C4'-P-C4' energy: -26.456 flat angles P-C4'-P energy: -13.237 tors. eta vs tors. theta energy: -6.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 5 Temperature: 0.900000 Total energy: -321.232391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -321.232391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -321.232391 (E_RNA) where: Base-Base interactions energy: -202.622 where: short stacking energy: -113.206 Base-Backbone interact. energy: -0.172 local terms energy: -118.437853 where: bonds (distance) C4'-P energy: -25.104 bonds (distance) P-C4' energy: -31.550 flat angles C4'-P-C4' energy: -25.328 flat angles P-C4'-P energy: -11.998 tors. eta vs tors. theta energy: -24.457 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 5 Temperature: 0.950000 Total energy: -303.765009 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.765009 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.765009 (E_RNA) where: Base-Base interactions energy: -186.603 where: short stacking energy: -119.852 Base-Backbone interact. energy: -1.422 local terms energy: -115.739936 where: bonds (distance) C4'-P energy: -20.020 bonds (distance) P-C4' energy: -21.730 flat angles C4'-P-C4' energy: -27.956 flat angles P-C4'-P energy: -19.727 tors. eta vs tors. theta energy: -26.307 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 5 Temperature: 1.000000 Total energy: -306.602458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.602458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.602458 (E_RNA) where: Base-Base interactions energy: -179.348 where: short stacking energy: -119.241 Base-Backbone interact. energy: -1.496 local terms energy: -125.758291 where: bonds (distance) C4'-P energy: -28.556 bonds (distance) P-C4' energy: -25.471 flat angles C4'-P-C4' energy: -21.931 flat angles P-C4'-P energy: -18.083 tors. eta vs tors. theta energy: -31.716 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 5 Temperature: 1.050000 Total energy: -308.287112 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.287112 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.287112 (E_RNA) where: Base-Base interactions energy: -184.058 where: short stacking energy: -102.064 Base-Backbone interact. energy: -0.665 local terms energy: -123.563635 where: bonds (distance) C4'-P energy: -26.189 bonds (distance) P-C4' energy: -23.512 flat angles C4'-P-C4' energy: -27.849 flat angles P-C4'-P energy: -17.441 tors. eta vs tors. theta energy: -28.573 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 5 ===================================== Write number: 5 Temperature: 1.100000 Total energy: -219.462741 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.462741 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.462741 (E_RNA) where: Base-Base interactions energy: -119.112 where: short stacking energy: -89.372 Base-Backbone interact. energy: -0.718 local terms energy: -99.632936 where: bonds (distance) C4'-P energy: -25.409 bonds (distance) P-C4' energy: -20.492 flat angles C4'-P-C4' energy: -19.593 flat angles P-C4'-P energy: -16.654 tors. eta vs tors. theta energy: -17.486 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 5 Temperature: 1.150000 Total energy: -280.092188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.092188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.092188 (E_RNA) where: Base-Base interactions energy: -181.297 where: short stacking energy: -94.252 Base-Backbone interact. energy: 1.362 local terms energy: -100.157189 where: bonds (distance) C4'-P energy: -20.969 bonds (distance) P-C4' energy: -23.327 flat angles C4'-P-C4' energy: -22.700 flat angles P-C4'-P energy: -17.509 tors. eta vs tors. theta energy: -15.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 5 Temperature: 1.200000 Total energy: -163.724539 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -163.724539 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -163.724539 (E_RNA) where: Base-Base interactions energy: -64.250 where: short stacking energy: -64.650 Base-Backbone interact. energy: -0.322 local terms energy: -99.152558 where: bonds (distance) C4'-P energy: -25.108 bonds (distance) P-C4' energy: -26.683 flat angles C4'-P-C4' energy: -27.461 flat angles P-C4'-P energy: -12.509 tors. eta vs tors. theta energy: -7.393 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 5 Temperature: 1.250000 Total energy: -247.364524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.364524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.364524 (E_RNA) where: Base-Base interactions energy: -147.061 where: short stacking energy: -85.407 Base-Backbone interact. energy: 0.650 local terms energy: -100.952696 where: bonds (distance) C4'-P energy: -18.860 bonds (distance) P-C4' energy: -25.712 flat angles C4'-P-C4' energy: -26.240 flat angles P-C4'-P energy: -10.984 tors. eta vs tors. theta energy: -19.157 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 5 Temperature: 1.300000 Total energy: -271.406156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.406156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.406156 (E_RNA) where: Base-Base interactions energy: -168.497 where: short stacking energy: -81.616 Base-Backbone interact. energy: -2.143 local terms energy: -100.766435 where: bonds (distance) C4'-P energy: -20.674 bonds (distance) P-C4' energy: -22.334 flat angles C4'-P-C4' energy: -18.428 flat angles P-C4'-P energy: -17.930 tors. eta vs tors. theta energy: -21.399 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 5 Temperature: 1.350000 Total energy: -127.245979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -127.245979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -127.245979 (E_RNA) where: Base-Base interactions energy: -43.999 where: short stacking energy: -40.272 Base-Backbone interact. energy: -0.787 local terms energy: -82.459452 where: bonds (distance) C4'-P energy: -28.991 bonds (distance) P-C4' energy: -19.688 flat angles C4'-P-C4' energy: -10.055 flat angles P-C4'-P energy: -16.341 tors. eta vs tors. theta energy: -7.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 6 Temperature: 0.900000 Total energy: -333.038662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.038662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.038662 (E_RNA) where: Base-Base interactions energy: -202.770 where: short stacking energy: -123.049 Base-Backbone interact. energy: -0.491 local terms energy: -129.777955 where: bonds (distance) C4'-P energy: -25.163 bonds (distance) P-C4' energy: -29.519 flat angles C4'-P-C4' energy: -29.519 flat angles P-C4'-P energy: -21.214 tors. eta vs tors. theta energy: -24.363 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 6 Temperature: 0.950000 Total energy: -311.177024 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -311.177024 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -311.177024 (E_RNA) where: Base-Base interactions energy: -197.473 where: short stacking energy: -96.863 Base-Backbone interact. energy: -0.261 local terms energy: -113.443442 where: bonds (distance) C4'-P energy: -21.745 bonds (distance) P-C4' energy: -28.252 flat angles C4'-P-C4' energy: -27.932 flat angles P-C4'-P energy: -16.307 tors. eta vs tors. theta energy: -19.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 6 Temperature: 1.000000 Total energy: -324.435754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -324.435754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -324.435754 (E_RNA) where: Base-Base interactions energy: -193.237 where: short stacking energy: -121.818 Base-Backbone interact. energy: -0.495 local terms energy: -130.704140 where: bonds (distance) C4'-P energy: -23.605 bonds (distance) P-C4' energy: -30.429 flat angles C4'-P-C4' energy: -25.344 flat angles P-C4'-P energy: -17.662 tors. eta vs tors. theta energy: -33.664 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 6 Temperature: 1.050000 Total energy: -325.953044 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.953044 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.953044 (E_RNA) where: Base-Base interactions energy: -208.066 where: short stacking energy: -104.116 Base-Backbone interact. energy: 1.353 local terms energy: -119.240387 where: bonds (distance) C4'-P energy: -26.494 bonds (distance) P-C4' energy: -19.913 flat angles C4'-P-C4' energy: -28.861 flat angles P-C4'-P energy: -18.044 tors. eta vs tors. theta energy: -25.929 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 6 Temperature: 1.100000 Total energy: -281.235622 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.235622 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.235622 (E_RNA) where: Base-Base interactions energy: -176.415 where: short stacking energy: -87.234 Base-Backbone interact. energy: -0.816 local terms energy: -104.004799 where: bonds (distance) C4'-P energy: -27.174 bonds (distance) P-C4' energy: -17.783 flat angles C4'-P-C4' energy: -28.363 flat angles P-C4'-P energy: -14.999 tors. eta vs tors. theta energy: -15.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 6 Temperature: 1.150000 Total energy: -203.790434 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.790434 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.790434 (E_RNA) where: Base-Base interactions energy: -105.389 where: short stacking energy: -57.635 Base-Backbone interact. energy: -0.768 local terms energy: -97.633942 where: bonds (distance) C4'-P energy: -27.838 bonds (distance) P-C4' energy: -19.877 flat angles C4'-P-C4' energy: -24.509 flat angles P-C4'-P energy: -18.864 tors. eta vs tors. theta energy: -6.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 6 Temperature: 1.200000 Total energy: -244.607278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.607278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.607278 (E_RNA) where: Base-Base interactions energy: -133.477 where: short stacking energy: -84.434 Base-Backbone interact. energy: -0.317 local terms energy: -110.813182 where: bonds (distance) C4'-P energy: -23.133 bonds (distance) P-C4' energy: -22.979 flat angles C4'-P-C4' energy: -25.039 flat angles P-C4'-P energy: -20.495 tors. eta vs tors. theta energy: -19.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 6 Temperature: 1.250000 Total energy: -168.948679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -168.948679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -168.948679 (E_RNA) where: Base-Base interactions energy: -88.568 where: short stacking energy: -42.727 Base-Backbone interact. energy: 2.577 local terms energy: -82.957933 where: bonds (distance) C4'-P energy: -23.648 bonds (distance) P-C4' energy: -18.990 flat angles C4'-P-C4' energy: -22.883 flat angles P-C4'-P energy: -12.984 tors. eta vs tors. theta energy: -4.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 9 ===================================== Write number: 6 Temperature: 1.300000 Total energy: -248.866064 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.866064 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.866064 (E_RNA) where: Base-Base interactions energy: -144.093 where: short stacking energy: -69.931 Base-Backbone interact. energy: 0.370 local terms energy: -105.143021 where: bonds (distance) C4'-P energy: -20.314 bonds (distance) P-C4' energy: -25.250 flat angles C4'-P-C4' energy: -21.647 flat angles P-C4'-P energy: -13.461 tors. eta vs tors. theta energy: -24.472 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 6 Temperature: 1.350000 Total energy: -121.112678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -121.112678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -121.112678 (E_RNA) where: Base-Base interactions energy: -45.702 where: short stacking energy: -44.045 Base-Backbone interact. energy: -0.751 local terms energy: -74.659341 where: bonds (distance) C4'-P energy: -16.178 bonds (distance) P-C4' energy: -21.860 flat angles C4'-P-C4' energy: -14.338 flat angles P-C4'-P energy: -19.824 tors. eta vs tors. theta energy: -2.459 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 7 Temperature: 0.900000 Total energy: -330.545260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.545260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.545260 (E_RNA) where: Base-Base interactions energy: -202.295 where: short stacking energy: -110.833 Base-Backbone interact. energy: -0.690 local terms energy: -127.560159 where: bonds (distance) C4'-P energy: -22.978 bonds (distance) P-C4' energy: -30.935 flat angles C4'-P-C4' energy: -27.809 flat angles P-C4'-P energy: -22.205 tors. eta vs tors. theta energy: -23.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 7 Temperature: 0.950000 Total energy: -342.198139 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.198139 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.198139 (E_RNA) where: Base-Base interactions energy: -207.442 where: short stacking energy: -131.335 Base-Backbone interact. energy: -1.204 local terms energy: -133.552104 where: bonds (distance) C4'-P energy: -29.115 bonds (distance) P-C4' energy: -26.970 flat angles C4'-P-C4' energy: -25.718 flat angles P-C4'-P energy: -18.977 tors. eta vs tors. theta energy: -32.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 7 Temperature: 1.000000 Total energy: -293.933102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.933102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.933102 (E_RNA) where: Base-Base interactions energy: -178.766 where: short stacking energy: -107.882 Base-Backbone interact. energy: -0.486 local terms energy: -114.681105 where: bonds (distance) C4'-P energy: -24.648 bonds (distance) P-C4' energy: -25.893 flat angles C4'-P-C4' energy: -22.930 flat angles P-C4'-P energy: -16.575 tors. eta vs tors. theta energy: -24.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 7 Temperature: 1.050000 Total energy: -342.407597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.407597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.407597 (E_RNA) where: Base-Base interactions energy: -224.081 where: short stacking energy: -98.087 Base-Backbone interact. energy: -0.345 local terms energy: -117.981545 where: bonds (distance) C4'-P energy: -26.228 bonds (distance) P-C4' energy: -27.129 flat angles C4'-P-C4' energy: -24.869 flat angles P-C4'-P energy: -17.497 tors. eta vs tors. theta energy: -22.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 7 Temperature: 1.100000 Total energy: -286.704557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.704557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.704557 (E_RNA) where: Base-Base interactions energy: -171.049 where: short stacking energy: -84.060 Base-Backbone interact. energy: -1.739 local terms energy: -113.916226 where: bonds (distance) C4'-P energy: -25.956 bonds (distance) P-C4' energy: -27.947 flat angles C4'-P-C4' energy: -25.146 flat angles P-C4'-P energy: -12.631 tors. eta vs tors. theta energy: -22.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 7 Temperature: 1.150000 Total energy: -274.012389 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.012389 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.012389 (E_RNA) where: Base-Base interactions energy: -167.614 where: short stacking energy: -96.831 Base-Backbone interact. energy: -0.174 local terms energy: -106.224995 where: bonds (distance) C4'-P energy: -28.805 bonds (distance) P-C4' energy: -20.701 flat angles C4'-P-C4' energy: -17.513 flat angles P-C4'-P energy: -18.092 tors. eta vs tors. theta energy: -21.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 7 Temperature: 1.200000 Total energy: -240.093401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.093401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.093401 (E_RNA) where: Base-Base interactions energy: -151.195 where: short stacking energy: -69.978 Base-Backbone interact. energy: -0.266 local terms energy: -88.632939 where: bonds (distance) C4'-P energy: -22.285 bonds (distance) P-C4' energy: -18.267 flat angles C4'-P-C4' energy: -27.543 flat angles P-C4'-P energy: -9.937 tors. eta vs tors. theta energy: -10.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 7 Temperature: 1.250000 Total energy: -252.237035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.237035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.237035 (E_RNA) where: Base-Base interactions energy: -151.953 where: short stacking energy: -82.032 Base-Backbone interact. energy: -1.129 local terms energy: -99.154875 where: bonds (distance) C4'-P energy: -22.621 bonds (distance) P-C4' energy: -22.356 flat angles C4'-P-C4' energy: -21.337 flat angles P-C4'-P energy: -14.796 tors. eta vs tors. theta energy: -18.045 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 7 Temperature: 1.300000 Total energy: -153.942070 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -153.942070 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -153.942070 (E_RNA) where: Base-Base interactions energy: -75.019 where: short stacking energy: -57.433 Base-Backbone interact. energy: 0.462 local terms energy: -79.384533 where: bonds (distance) C4'-P energy: -10.293 bonds (distance) P-C4' energy: -27.177 flat angles C4'-P-C4' energy: -17.583 flat angles P-C4'-P energy: -11.257 tors. eta vs tors. theta energy: -13.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 7 Temperature: 1.350000 Total energy: -151.558357 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.558357 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.558357 (E_RNA) where: Base-Base interactions energy: -70.708 where: short stacking energy: -56.495 Base-Backbone interact. energy: -0.275 local terms energy: -80.575493 where: bonds (distance) C4'-P energy: -23.543 bonds (distance) P-C4' energy: -24.537 flat angles C4'-P-C4' energy: -16.483 flat angles P-C4'-P energy: -12.476 tors. eta vs tors. theta energy: -3.536 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 8 Temperature: 0.900000 Total energy: -355.839265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.839265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.839265 (E_RNA) where: Base-Base interactions energy: -221.881 where: short stacking energy: -111.702 Base-Backbone interact. energy: -0.025 local terms energy: -133.932903 where: bonds (distance) C4'-P energy: -24.670 bonds (distance) P-C4' energy: -29.044 flat angles C4'-P-C4' energy: -29.171 flat angles P-C4'-P energy: -18.716 tors. eta vs tors. theta energy: -32.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 8 Temperature: 0.950000 Total energy: -349.301657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -349.301657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -349.301657 (E_RNA) where: Base-Base interactions energy: -215.046 where: short stacking energy: -122.905 Base-Backbone interact. energy: -0.206 local terms energy: -134.049615 where: bonds (distance) C4'-P energy: -25.580 bonds (distance) P-C4' energy: -30.084 flat angles C4'-P-C4' energy: -28.782 flat angles P-C4'-P energy: -19.804 tors. eta vs tors. theta energy: -29.800 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 8 Temperature: 1.000000 Total energy: -319.461996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -319.461996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -319.461996 (E_RNA) where: Base-Base interactions energy: -203.970 where: short stacking energy: -111.286 Base-Backbone interact. energy: -0.131 local terms energy: -115.360683 where: bonds (distance) C4'-P energy: -20.269 bonds (distance) P-C4' energy: -20.517 flat angles C4'-P-C4' energy: -30.123 flat angles P-C4'-P energy: -18.507 tors. eta vs tors. theta energy: -25.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 8 Temperature: 1.050000 Total energy: -341.932003 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.932003 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.932003 (E_RNA) where: Base-Base interactions energy: -223.640 where: short stacking energy: -114.948 Base-Backbone interact. energy: 1.870 local terms energy: -120.162387 where: bonds (distance) C4'-P energy: -24.662 bonds (distance) P-C4' energy: -28.297 flat angles C4'-P-C4' energy: -22.753 flat angles P-C4'-P energy: -17.075 tors. eta vs tors. theta energy: -27.374 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 8 Temperature: 1.100000 Total energy: -296.661819 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.661819 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.661819 (E_RNA) where: Base-Base interactions energy: -178.689 where: short stacking energy: -114.576 Base-Backbone interact. energy: -0.187 local terms energy: -117.786069 where: bonds (distance) C4'-P energy: -24.000 bonds (distance) P-C4' energy: -19.469 flat angles C4'-P-C4' energy: -28.459 flat angles P-C4'-P energy: -12.836 tors. eta vs tors. theta energy: -33.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 8 Temperature: 1.150000 Total energy: -307.978797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.978797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.978797 (E_RNA) where: Base-Base interactions energy: -195.240 where: short stacking energy: -97.930 Base-Backbone interact. energy: -0.852 local terms energy: -111.886835 where: bonds (distance) C4'-P energy: -21.849 bonds (distance) P-C4' energy: -21.881 flat angles C4'-P-C4' energy: -24.032 flat angles P-C4'-P energy: -20.788 tors. eta vs tors. theta energy: -23.337 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 8 Temperature: 1.200000 Total energy: -262.391585 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.391585 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.391585 (E_RNA) where: Base-Base interactions energy: -156.594 where: short stacking energy: -83.839 Base-Backbone interact. energy: 0.342 local terms energy: -106.138897 where: bonds (distance) C4'-P energy: -24.328 bonds (distance) P-C4' energy: -20.278 flat angles C4'-P-C4' energy: -21.600 flat angles P-C4'-P energy: -16.967 tors. eta vs tors. theta energy: -22.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 8 Temperature: 1.250000 Total energy: -226.924371 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.924371 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.924371 (E_RNA) where: Base-Base interactions energy: -138.484 where: short stacking energy: -81.072 Base-Backbone interact. energy: -0.081 local terms energy: -88.358746 where: bonds (distance) C4'-P energy: -21.134 bonds (distance) P-C4' energy: -24.307 flat angles C4'-P-C4' energy: -19.021 flat angles P-C4'-P energy: -7.398 tors. eta vs tors. theta energy: -16.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 8 Temperature: 1.300000 Total energy: -150.660661 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -150.660661 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -150.660661 (E_RNA) where: Base-Base interactions energy: -81.562 where: short stacking energy: -57.215 Base-Backbone interact. energy: 0.496 local terms energy: -69.594520 where: bonds (distance) C4'-P energy: -10.010 bonds (distance) P-C4' energy: -23.578 flat angles C4'-P-C4' energy: -20.817 flat angles P-C4'-P energy: -8.651 tors. eta vs tors. theta energy: -6.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 8 Temperature: 1.350000 Total energy: -167.234844 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -167.234844 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -167.234844 (E_RNA) where: Base-Base interactions energy: -94.395 where: short stacking energy: -57.337 Base-Backbone interact. energy: 0.321 local terms energy: -73.160524 where: bonds (distance) C4'-P energy: -19.557 bonds (distance) P-C4' energy: -22.865 flat angles C4'-P-C4' energy: -11.899 flat angles P-C4'-P energy: -11.079 tors. eta vs tors. theta energy: -7.761 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 9 Temperature: 0.900000 Total energy: -347.912993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.912993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.912993 (E_RNA) where: Base-Base interactions energy: -220.585 where: short stacking energy: -117.860 Base-Backbone interact. energy: 0.450 local terms energy: -127.778412 where: bonds (distance) C4'-P energy: -24.280 bonds (distance) P-C4' energy: -26.880 flat angles C4'-P-C4' energy: -25.431 flat angles P-C4'-P energy: -21.107 tors. eta vs tors. theta energy: -30.080 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 9 Temperature: 0.950000 Total energy: -331.646405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.646405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.646405 (E_RNA) where: Base-Base interactions energy: -202.679 where: short stacking energy: -123.111 Base-Backbone interact. energy: 0.145 local terms energy: -129.112356 where: bonds (distance) C4'-P energy: -25.782 bonds (distance) P-C4' energy: -27.518 flat angles C4'-P-C4' energy: -27.095 flat angles P-C4'-P energy: -18.967 tors. eta vs tors. theta energy: -29.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 9 Temperature: 1.000000 Total energy: -325.674513 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -325.674513 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -325.674513 (E_RNA) where: Base-Base interactions energy: -209.520 where: short stacking energy: -109.167 Base-Backbone interact. energy: -0.028 local terms energy: -116.126290 where: bonds (distance) C4'-P energy: -22.970 bonds (distance) P-C4' energy: -27.668 flat angles C4'-P-C4' energy: -24.420 flat angles P-C4'-P energy: -17.371 tors. eta vs tors. theta energy: -23.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 9 Temperature: 1.050000 Total energy: -364.198058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.198058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.198058 (E_RNA) where: Base-Base interactions energy: -251.454 where: short stacking energy: -126.655 Base-Backbone interact. energy: -0.621 local terms energy: -112.122733 where: bonds (distance) C4'-P energy: -23.756 bonds (distance) P-C4' energy: -26.019 flat angles C4'-P-C4' energy: -24.507 flat angles P-C4'-P energy: -9.454 tors. eta vs tors. theta energy: -28.386 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 8 ===================================== Write number: 9 Temperature: 1.100000 Total energy: -291.107515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.107515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.107515 (E_RNA) where: Base-Base interactions energy: -178.186 where: short stacking energy: -101.310 Base-Backbone interact. energy: -0.166 local terms energy: -112.755278 where: bonds (distance) C4'-P energy: -25.505 bonds (distance) P-C4' energy: -24.185 flat angles C4'-P-C4' energy: -24.607 flat angles P-C4'-P energy: -16.263 tors. eta vs tors. theta energy: -22.196 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 7 ===================================== Write number: 9 Temperature: 1.150000 Total energy: -306.459998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.459998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.459998 (E_RNA) where: Base-Base interactions energy: -188.791 where: short stacking energy: -104.084 Base-Backbone interact. energy: -2.193 local terms energy: -115.476420 where: bonds (distance) C4'-P energy: -27.073 bonds (distance) P-C4' energy: -27.938 flat angles C4'-P-C4' energy: -25.511 flat angles P-C4'-P energy: -10.261 tors. eta vs tors. theta energy: -24.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 9 Temperature: 1.200000 Total energy: -258.352503 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.352503 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.352503 (E_RNA) where: Base-Base interactions energy: -157.219 where: short stacking energy: -93.041 Base-Backbone interact. energy: 1.752 local terms energy: -102.884766 where: bonds (distance) C4'-P energy: -22.500 bonds (distance) P-C4' energy: -28.946 flat angles C4'-P-C4' energy: -13.595 flat angles P-C4'-P energy: -17.955 tors. eta vs tors. theta energy: -19.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 9 Temperature: 1.250000 Total energy: -252.709149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.709149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.709149 (E_RNA) where: Base-Base interactions energy: -147.940 where: short stacking energy: -79.932 Base-Backbone interact. energy: -0.038 local terms energy: -104.731169 where: bonds (distance) C4'-P energy: -26.893 bonds (distance) P-C4' energy: -23.840 flat angles C4'-P-C4' energy: -17.034 flat angles P-C4'-P energy: -17.159 tors. eta vs tors. theta energy: -19.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 9 Temperature: 1.300000 Total energy: -143.834685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -143.834685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -143.834685 (E_RNA) where: Base-Base interactions energy: -51.787 where: short stacking energy: -41.765 Base-Backbone interact. energy: -0.551 local terms energy: -91.496529 where: bonds (distance) C4'-P energy: -26.356 bonds (distance) P-C4' energy: -28.831 flat angles C4'-P-C4' energy: -18.271 flat angles P-C4'-P energy: -9.440 tors. eta vs tors. theta energy: -8.598 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 9 Temperature: 1.350000 Total energy: -132.458895 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.458895 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.458895 (E_RNA) where: Base-Base interactions energy: -57.872 where: short stacking energy: -40.593 Base-Backbone interact. energy: -1.058 local terms energy: -73.528374 where: bonds (distance) C4'-P energy: -16.739 bonds (distance) P-C4' energy: -24.134 flat angles C4'-P-C4' energy: -24.775 flat angles P-C4'-P energy: -10.377 tors. eta vs tors. theta energy: 2.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 10 Temperature: 0.900000 Total energy: -369.305735 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.305735 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.305735 (E_RNA) where: Base-Base interactions energy: -241.898 where: short stacking energy: -131.094 Base-Backbone interact. energy: -0.463 local terms energy: -126.944312 where: bonds (distance) C4'-P energy: -25.409 bonds (distance) P-C4' energy: -26.615 flat angles C4'-P-C4' energy: -26.299 flat angles P-C4'-P energy: -14.259 tors. eta vs tors. theta energy: -34.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 10 Temperature: 0.950000 Total energy: -348.595315 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.595315 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.595315 (E_RNA) where: Base-Base interactions energy: -231.334 where: short stacking energy: -102.483 Base-Backbone interact. energy: -0.445 local terms energy: -116.816156 where: bonds (distance) C4'-P energy: -23.335 bonds (distance) P-C4' energy: -23.708 flat angles C4'-P-C4' energy: -25.769 flat angles P-C4'-P energy: -20.907 tors. eta vs tors. theta energy: -23.097 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 10 Temperature: 1.000000 Total energy: -368.189177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.189177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.189177 (E_RNA) where: Base-Base interactions energy: -250.566 where: short stacking energy: -117.372 Base-Backbone interact. energy: 0.177 local terms energy: -117.800206 where: bonds (distance) C4'-P energy: -20.367 bonds (distance) P-C4' energy: -24.868 flat angles C4'-P-C4' energy: -27.106 flat angles P-C4'-P energy: -17.690 tors. eta vs tors. theta energy: -27.769 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 10 Temperature: 1.050000 Total energy: -296.492862 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.492862 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.492862 (E_RNA) where: Base-Base interactions energy: -175.777 where: short stacking energy: -101.598 Base-Backbone interact. energy: -0.587 local terms energy: -120.129585 where: bonds (distance) C4'-P energy: -25.728 bonds (distance) P-C4' energy: -26.569 flat angles C4'-P-C4' energy: -29.722 flat angles P-C4'-P energy: -16.702 tors. eta vs tors. theta energy: -21.408 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 10 Temperature: 1.100000 Total energy: -331.602213 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.602213 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.602213 (E_RNA) where: Base-Base interactions energy: -218.026 where: short stacking energy: -121.030 Base-Backbone interact. energy: -0.651 local terms energy: -112.925098 where: bonds (distance) C4'-P energy: -23.077 bonds (distance) P-C4' energy: -19.292 flat angles C4'-P-C4' energy: -27.897 flat angles P-C4'-P energy: -10.365 tors. eta vs tors. theta energy: -32.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 10 Temperature: 1.150000 Total energy: -254.184069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.184069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.184069 (E_RNA) where: Base-Base interactions energy: -156.095 where: short stacking energy: -79.595 Base-Backbone interact. energy: -0.489 local terms energy: -97.599603 where: bonds (distance) C4'-P energy: -18.238 bonds (distance) P-C4' energy: -24.007 flat angles C4'-P-C4' energy: -24.068 flat angles P-C4'-P energy: -17.319 tors. eta vs tors. theta energy: -13.967 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 10 Temperature: 1.200000 Total energy: -266.205254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.205254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.205254 (E_RNA) where: Base-Base interactions energy: -158.942 where: short stacking energy: -91.020 Base-Backbone interact. energy: -0.701 local terms energy: -106.561832 where: bonds (distance) C4'-P energy: -23.209 bonds (distance) P-C4' energy: -22.695 flat angles C4'-P-C4' energy: -27.639 flat angles P-C4'-P energy: -10.046 tors. eta vs tors. theta energy: -22.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 10 Temperature: 1.250000 Total energy: -257.376468 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.376468 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.376468 (E_RNA) where: Base-Base interactions energy: -153.991 where: short stacking energy: -79.942 Base-Backbone interact. energy: -0.362 local terms energy: -103.023479 where: bonds (distance) C4'-P energy: -29.848 bonds (distance) P-C4' energy: -23.059 flat angles C4'-P-C4' energy: -21.533 flat angles P-C4'-P energy: -12.543 tors. eta vs tors. theta energy: -16.040 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 10 Temperature: 1.300000 Total energy: -134.542320 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -134.542320 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -134.542320 (E_RNA) where: Base-Base interactions energy: -57.804 where: short stacking energy: -57.032 Base-Backbone interact. energy: -0.213 local terms energy: -76.525925 where: bonds (distance) C4'-P energy: -19.489 bonds (distance) P-C4' energy: -19.887 flat angles C4'-P-C4' energy: -21.965 flat angles P-C4'-P energy: -13.970 tors. eta vs tors. theta energy: -1.216 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 10 Temperature: 1.350000 Total energy: -136.491167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.491167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.491167 (E_RNA) where: Base-Base interactions energy: -55.052 where: short stacking energy: -47.716 Base-Backbone interact. energy: -0.643 local terms energy: -80.795663 where: bonds (distance) C4'-P energy: -25.564 bonds (distance) P-C4' energy: -22.333 flat angles C4'-P-C4' energy: -16.066 flat angles P-C4'-P energy: -15.596 tors. eta vs tors. theta energy: -1.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 11 Temperature: 0.900000 Total energy: -376.705178 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.705178 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.705178 (E_RNA) where: Base-Base interactions energy: -239.038 where: short stacking energy: -128.873 Base-Backbone interact. energy: -1.959 local terms energy: -135.708100 where: bonds (distance) C4'-P energy: -25.664 bonds (distance) P-C4' energy: -28.285 flat angles C4'-P-C4' energy: -25.896 flat angles P-C4'-P energy: -20.517 tors. eta vs tors. theta energy: -35.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 11 Temperature: 0.950000 Total energy: -347.065179 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.065179 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.065179 (E_RNA) where: Base-Base interactions energy: -224.133 where: short stacking energy: -104.550 Base-Backbone interact. energy: -0.248 local terms energy: -122.683995 where: bonds (distance) C4'-P energy: -24.106 bonds (distance) P-C4' energy: -29.056 flat angles C4'-P-C4' energy: -25.964 flat angles P-C4'-P energy: -18.524 tors. eta vs tors. theta energy: -25.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 11 Temperature: 1.000000 Total energy: -365.213846 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.213846 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.213846 (E_RNA) where: Base-Base interactions energy: -241.379 where: short stacking energy: -111.348 Base-Backbone interact. energy: -0.367 local terms energy: -123.468234 where: bonds (distance) C4'-P energy: -26.941 bonds (distance) P-C4' energy: -29.277 flat angles C4'-P-C4' energy: -25.115 flat angles P-C4'-P energy: -18.953 tors. eta vs tors. theta energy: -23.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 11 Temperature: 1.050000 Total energy: -337.668358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.668358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.668358 (E_RNA) where: Base-Base interactions energy: -218.852 where: short stacking energy: -112.223 Base-Backbone interact. energy: -0.699 local terms energy: -118.117082 where: bonds (distance) C4'-P energy: -22.807 bonds (distance) P-C4' energy: -26.148 flat angles C4'-P-C4' energy: -21.626 flat angles P-C4'-P energy: -20.359 tors. eta vs tors. theta energy: -27.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 11 Temperature: 1.100000 Total energy: -284.129658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.129658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.129658 (E_RNA) where: Base-Base interactions energy: -173.899 where: short stacking energy: -83.996 Base-Backbone interact. energy: -2.369 local terms energy: -107.860854 where: bonds (distance) C4'-P energy: -20.784 bonds (distance) P-C4' energy: -28.619 flat angles C4'-P-C4' energy: -23.447 flat angles P-C4'-P energy: -15.707 tors. eta vs tors. theta energy: -19.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 11 Temperature: 1.150000 Total energy: -232.564768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.564768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.564768 (E_RNA) where: Base-Base interactions energy: -137.593 where: short stacking energy: -74.591 Base-Backbone interact. energy: -0.104 local terms energy: -94.867849 where: bonds (distance) C4'-P energy: -25.907 bonds (distance) P-C4' energy: -19.965 flat angles C4'-P-C4' energy: -18.363 flat angles P-C4'-P energy: -18.949 tors. eta vs tors. theta energy: -11.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 11 Temperature: 1.200000 Total energy: -267.032143 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.032143 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.032143 (E_RNA) where: Base-Base interactions energy: -163.579 where: short stacking energy: -73.857 Base-Backbone interact. energy: -0.209 local terms energy: -103.244017 where: bonds (distance) C4'-P energy: -21.288 bonds (distance) P-C4' energy: -28.238 flat angles C4'-P-C4' energy: -24.932 flat angles P-C4'-P energy: -11.863 tors. eta vs tors. theta energy: -16.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 11 Temperature: 1.250000 Total energy: -242.808949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.808949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.808949 (E_RNA) where: Base-Base interactions energy: -138.181 where: short stacking energy: -70.240 Base-Backbone interact. energy: 3.195 local terms energy: -107.823210 where: bonds (distance) C4'-P energy: -25.055 bonds (distance) P-C4' energy: -22.068 flat angles C4'-P-C4' energy: -24.725 flat angles P-C4'-P energy: -18.700 tors. eta vs tors. theta energy: -17.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 11 Temperature: 1.300000 Total energy: -148.429364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.429364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.429364 (E_RNA) where: Base-Base interactions energy: -53.515 where: short stacking energy: -52.422 Base-Backbone interact. energy: 0.442 local terms energy: -95.356711 where: bonds (distance) C4'-P energy: -24.389 bonds (distance) P-C4' energy: -23.483 flat angles C4'-P-C4' energy: -20.021 flat angles P-C4'-P energy: -11.377 tors. eta vs tors. theta energy: -16.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 11 Temperature: 1.350000 Total energy: -141.764219 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -141.764219 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -141.764219 (E_RNA) where: Base-Base interactions energy: -56.521 where: short stacking energy: -55.693 Base-Backbone interact. energy: 0.755 local terms energy: -85.998524 where: bonds (distance) C4'-P energy: -22.302 bonds (distance) P-C4' energy: -29.048 flat angles C4'-P-C4' energy: -17.660 flat angles P-C4'-P energy: -11.644 tors. eta vs tors. theta energy: -5.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 12 Temperature: 0.900000 Total energy: -364.776145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.776145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.776145 (E_RNA) where: Base-Base interactions energy: -245.869 where: short stacking energy: -117.259 Base-Backbone interact. energy: -0.428 local terms energy: -118.479031 where: bonds (distance) C4'-P energy: -23.083 bonds (distance) P-C4' energy: -23.860 flat angles C4'-P-C4' energy: -26.623 flat angles P-C4'-P energy: -15.939 tors. eta vs tors. theta energy: -28.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 12 Temperature: 0.950000 Total energy: -359.035774 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.035774 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.035774 (E_RNA) where: Base-Base interactions energy: -226.164 where: short stacking energy: -123.323 Base-Backbone interact. energy: -0.261 local terms energy: -132.610779 where: bonds (distance) C4'-P energy: -29.001 bonds (distance) P-C4' energy: -25.636 flat angles C4'-P-C4' energy: -29.152 flat angles P-C4'-P energy: -16.288 tors. eta vs tors. theta energy: -32.534 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 12 Temperature: 1.000000 Total energy: -370.557787 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.557787 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.557787 (E_RNA) where: Base-Base interactions energy: -247.958 where: short stacking energy: -117.872 Base-Backbone interact. energy: -0.103 local terms energy: -122.496749 where: bonds (distance) C4'-P energy: -29.013 bonds (distance) P-C4' energy: -26.890 flat angles C4'-P-C4' energy: -23.853 flat angles P-C4'-P energy: -14.224 tors. eta vs tors. theta energy: -28.517 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 12 Temperature: 1.050000 Total energy: -358.637567 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.637567 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.637567 (E_RNA) where: Base-Base interactions energy: -232.238 where: short stacking energy: -115.061 Base-Backbone interact. energy: -0.439 local terms energy: -125.960388 where: bonds (distance) C4'-P energy: -29.184 bonds (distance) P-C4' energy: -23.776 flat angles C4'-P-C4' energy: -28.531 flat angles P-C4'-P energy: -13.783 tors. eta vs tors. theta energy: -30.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 12 Temperature: 1.100000 Total energy: -306.470013 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -306.470013 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -306.470013 (E_RNA) where: Base-Base interactions energy: -198.175 where: short stacking energy: -103.236 Base-Backbone interact. energy: -0.293 local terms energy: -108.002535 where: bonds (distance) C4'-P energy: -21.844 bonds (distance) P-C4' energy: -25.263 flat angles C4'-P-C4' energy: -26.667 flat angles P-C4'-P energy: -16.237 tors. eta vs tors. theta energy: -17.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 5 ===================================== Write number: 12 Temperature: 1.150000 Total energy: -264.512354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.512354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.512354 (E_RNA) where: Base-Base interactions energy: -158.952 where: short stacking energy: -97.895 Base-Backbone interact. energy: -0.241 local terms energy: -105.318927 where: bonds (distance) C4'-P energy: -23.602 bonds (distance) P-C4' energy: -25.629 flat angles C4'-P-C4' energy: -28.102 flat angles P-C4'-P energy: -5.088 tors. eta vs tors. theta energy: -22.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 12 Temperature: 1.200000 Total energy: -247.954789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.954789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.954789 (E_RNA) where: Base-Base interactions energy: -145.842 where: short stacking energy: -67.859 Base-Backbone interact. energy: 2.515 local terms energy: -104.627218 where: bonds (distance) C4'-P energy: -26.822 bonds (distance) P-C4' energy: -22.190 flat angles C4'-P-C4' energy: -27.838 flat angles P-C4'-P energy: -16.719 tors. eta vs tors. theta energy: -11.058 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 12 Temperature: 1.250000 Total energy: -241.669159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.669159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.669159 (E_RNA) where: Base-Base interactions energy: -134.492 where: short stacking energy: -70.037 Base-Backbone interact. energy: -1.823 local terms energy: -105.354219 where: bonds (distance) C4'-P energy: -30.972 bonds (distance) P-C4' energy: -24.106 flat angles C4'-P-C4' energy: -24.412 flat angles P-C4'-P energy: -14.698 tors. eta vs tors. theta energy: -11.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 12 Temperature: 1.300000 Total energy: -136.486028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -136.486028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -136.486028 (E_RNA) where: Base-Base interactions energy: -53.463 where: short stacking energy: -53.463 Base-Backbone interact. energy: -0.533 local terms energy: -82.490270 where: bonds (distance) C4'-P energy: -24.623 bonds (distance) P-C4' energy: -21.259 flat angles C4'-P-C4' energy: -16.125 flat angles P-C4'-P energy: -13.836 tors. eta vs tors. theta energy: -6.648 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 12 Temperature: 1.350000 Total energy: -151.841116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -151.841116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -151.841116 (E_RNA) where: Base-Base interactions energy: -67.757 where: short stacking energy: -58.870 Base-Backbone interact. energy: -0.538 local terms energy: -83.546582 where: bonds (distance) C4'-P energy: -16.956 bonds (distance) P-C4' energy: -22.226 flat angles C4'-P-C4' energy: -24.568 flat angles P-C4'-P energy: -16.793 tors. eta vs tors. theta energy: -3.004 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 13 Temperature: 0.900000 Total energy: -358.114039 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.114039 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.114039 (E_RNA) where: Base-Base interactions energy: -224.732 where: short stacking energy: -121.280 Base-Backbone interact. energy: -2.237 local terms energy: -131.145764 where: bonds (distance) C4'-P energy: -28.912 bonds (distance) P-C4' energy: -31.601 flat angles C4'-P-C4' energy: -27.234 flat angles P-C4'-P energy: -14.659 tors. eta vs tors. theta energy: -28.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 13 Temperature: 0.950000 Total energy: -400.121153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.121153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.121153 (E_RNA) where: Base-Base interactions energy: -271.481 where: short stacking energy: -117.302 Base-Backbone interact. energy: -2.246 local terms energy: -126.394886 where: bonds (distance) C4'-P energy: -25.072 bonds (distance) P-C4' energy: -26.107 flat angles C4'-P-C4' energy: -27.058 flat angles P-C4'-P energy: -19.117 tors. eta vs tors. theta energy: -29.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 13 Temperature: 1.000000 Total energy: -327.227260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -327.227260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -327.227260 (E_RNA) where: Base-Base interactions energy: -213.946 where: short stacking energy: -102.082 Base-Backbone interact. energy: -2.673 local terms energy: -110.608155 where: bonds (distance) C4'-P energy: -25.208 bonds (distance) P-C4' energy: -23.097 flat angles C4'-P-C4' energy: -22.552 flat angles P-C4'-P energy: -20.622 tors. eta vs tors. theta energy: -19.129 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 13 Temperature: 1.050000 Total energy: -333.724382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.724382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.724382 (E_RNA) where: Base-Base interactions energy: -215.810 where: short stacking energy: -130.451 Base-Backbone interact. energy: 1.021 local terms energy: -118.935952 where: bonds (distance) C4'-P energy: -22.537 bonds (distance) P-C4' energy: -28.157 flat angles C4'-P-C4' energy: -28.784 flat angles P-C4'-P energy: -11.027 tors. eta vs tors. theta energy: -28.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 13 Temperature: 1.100000 Total energy: -341.458919 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.458919 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.458919 (E_RNA) where: Base-Base interactions energy: -209.480 where: short stacking energy: -101.689 Base-Backbone interact. energy: -0.506 local terms energy: -131.473084 where: bonds (distance) C4'-P energy: -30.118 bonds (distance) P-C4' energy: -28.555 flat angles C4'-P-C4' energy: -24.341 flat angles P-C4'-P energy: -19.969 tors. eta vs tors. theta energy: -28.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 13 Temperature: 1.150000 Total energy: -280.677879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.677879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.677879 (E_RNA) where: Base-Base interactions energy: -188.451 where: short stacking energy: -102.337 Base-Backbone interact. energy: -0.308 local terms energy: -91.919588 where: bonds (distance) C4'-P energy: -17.994 bonds (distance) P-C4' energy: -17.058 flat angles C4'-P-C4' energy: -26.361 flat angles P-C4'-P energy: -11.073 tors. eta vs tors. theta energy: -19.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 13 Temperature: 1.200000 Total energy: -262.584927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.584927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.584927 (E_RNA) where: Base-Base interactions energy: -155.018 where: short stacking energy: -81.910 Base-Backbone interact. energy: -0.665 local terms energy: -106.901177 where: bonds (distance) C4'-P energy: -19.940 bonds (distance) P-C4' energy: -27.935 flat angles C4'-P-C4' energy: -19.901 flat angles P-C4'-P energy: -21.609 tors. eta vs tors. theta energy: -17.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 13 Temperature: 1.250000 Total energy: -252.257286 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.257286 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.257286 (E_RNA) where: Base-Base interactions energy: -146.925 where: short stacking energy: -69.927 Base-Backbone interact. energy: -2.813 local terms energy: -102.518653 where: bonds (distance) C4'-P energy: -23.755 bonds (distance) P-C4' energy: -24.707 flat angles C4'-P-C4' energy: -22.733 flat angles P-C4'-P energy: -16.604 tors. eta vs tors. theta energy: -14.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 13 Temperature: 1.300000 Total energy: -145.270952 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -145.270952 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -145.270952 (E_RNA) where: Base-Base interactions energy: -61.190 where: short stacking energy: -43.011 Base-Backbone interact. energy: -0.179 local terms energy: -83.902530 where: bonds (distance) C4'-P energy: -15.921 bonds (distance) P-C4' energy: -20.919 flat angles C4'-P-C4' energy: -17.206 flat angles P-C4'-P energy: -17.053 tors. eta vs tors. theta energy: -12.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 13 Temperature: 1.350000 Total energy: -157.225795 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -157.225795 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -157.225795 (E_RNA) where: Base-Base interactions energy: -67.816 where: short stacking energy: -62.417 Base-Backbone interact. energy: 0.720 local terms energy: -90.129662 where: bonds (distance) C4'-P energy: -21.833 bonds (distance) P-C4' energy: -26.043 flat angles C4'-P-C4' energy: -18.686 flat angles P-C4'-P energy: -18.339 tors. eta vs tors. theta energy: -5.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 14 Temperature: 0.900000 Total energy: -414.590465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.590465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.590465 (E_RNA) where: Base-Base interactions energy: -286.248 where: short stacking energy: -130.106 Base-Backbone interact. energy: -0.913 local terms energy: -127.429533 where: bonds (distance) C4'-P energy: -24.712 bonds (distance) P-C4' energy: -25.872 flat angles C4'-P-C4' energy: -29.671 flat angles P-C4'-P energy: -12.997 tors. eta vs tors. theta energy: -34.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 14 Temperature: 0.950000 Total energy: -376.815626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -376.815626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -376.815626 (E_RNA) where: Base-Base interactions energy: -249.819 where: short stacking energy: -117.455 Base-Backbone interact. energy: 1.820 local terms energy: -128.816673 where: bonds (distance) C4'-P energy: -27.721 bonds (distance) P-C4' energy: -20.999 flat angles C4'-P-C4' energy: -28.033 flat angles P-C4'-P energy: -21.215 tors. eta vs tors. theta energy: -30.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 14 Temperature: 1.000000 Total energy: -344.527511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.527511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.527511 (E_RNA) where: Base-Base interactions energy: -221.276 where: short stacking energy: -108.773 Base-Backbone interact. energy: -0.821 local terms energy: -122.430304 where: bonds (distance) C4'-P energy: -25.941 bonds (distance) P-C4' energy: -27.419 flat angles C4'-P-C4' energy: -24.130 flat angles P-C4'-P energy: -14.794 tors. eta vs tors. theta energy: -30.147 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 14 Temperature: 1.050000 Total energy: -316.761335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -316.761335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -316.761335 (E_RNA) where: Base-Base interactions energy: -206.738 where: short stacking energy: -102.658 Base-Backbone interact. energy: -2.725 local terms energy: -107.297844 where: bonds (distance) C4'-P energy: -14.953 bonds (distance) P-C4' energy: -25.376 flat angles C4'-P-C4' energy: -26.286 flat angles P-C4'-P energy: -21.162 tors. eta vs tors. theta energy: -19.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 7 ===================================== Write number: 14 Temperature: 1.100000 Total energy: -350.816449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.816449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.816449 (E_RNA) where: Base-Base interactions energy: -238.418 where: short stacking energy: -119.368 Base-Backbone interact. energy: -0.622 local terms energy: -111.775985 where: bonds (distance) C4'-P energy: -25.427 bonds (distance) P-C4' energy: -26.775 flat angles C4'-P-C4' energy: -14.775 flat angles P-C4'-P energy: -14.605 tors. eta vs tors. theta energy: -30.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 14 Temperature: 1.150000 Total energy: -305.188397 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.188397 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.188397 (E_RNA) where: Base-Base interactions energy: -205.781 where: short stacking energy: -90.404 Base-Backbone interact. energy: -0.179 local terms energy: -99.228495 where: bonds (distance) C4'-P energy: -21.143 bonds (distance) P-C4' energy: -23.030 flat angles C4'-P-C4' energy: -21.143 flat angles P-C4'-P energy: -17.339 tors. eta vs tors. theta energy: -16.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 14 Temperature: 1.200000 Total energy: -271.786500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.786500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.786500 (E_RNA) where: Base-Base interactions energy: -163.589 where: short stacking energy: -102.187 Base-Backbone interact. energy: -2.063 local terms energy: -106.134619 where: bonds (distance) C4'-P energy: -20.923 bonds (distance) P-C4' energy: -26.416 flat angles C4'-P-C4' energy: -26.800 flat angles P-C4'-P energy: -11.871 tors. eta vs tors. theta energy: -20.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 14 Temperature: 1.250000 Total energy: -263.373731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -263.373731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -263.373731 (E_RNA) where: Base-Base interactions energy: -156.295 where: short stacking energy: -95.104 Base-Backbone interact. energy: -0.283 local terms energy: -106.795626 where: bonds (distance) C4'-P energy: -20.798 bonds (distance) P-C4' energy: -25.323 flat angles C4'-P-C4' energy: -17.588 flat angles P-C4'-P energy: -19.185 tors. eta vs tors. theta energy: -23.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 14 Temperature: 1.300000 Total energy: -142.379743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.379743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.379743 (E_RNA) where: Base-Base interactions energy: -60.126 where: short stacking energy: -56.580 Base-Backbone interact. energy: -0.292 local terms energy: -81.962560 where: bonds (distance) C4'-P energy: -24.277 bonds (distance) P-C4' energy: -28.111 flat angles C4'-P-C4' energy: -14.170 flat angles P-C4'-P energy: -13.802 tors. eta vs tors. theta energy: -1.603 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 14 Temperature: 1.350000 Total energy: -147.539951 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -147.539951 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -147.539951 (E_RNA) where: Base-Base interactions energy: -70.913 where: short stacking energy: -51.783 Base-Backbone interact. energy: 2.623 local terms energy: -79.249320 where: bonds (distance) C4'-P energy: -16.001 bonds (distance) P-C4' energy: -25.131 flat angles C4'-P-C4' energy: -22.687 flat angles P-C4'-P energy: -6.223 tors. eta vs tors. theta energy: -9.208 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 15 Temperature: 0.900000 Total energy: -404.445972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.445972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.445972 (E_RNA) where: Base-Base interactions energy: -285.154 where: short stacking energy: -126.268 Base-Backbone interact. energy: 0.318 local terms energy: -119.610202 where: bonds (distance) C4'-P energy: -27.414 bonds (distance) P-C4' energy: -19.453 flat angles C4'-P-C4' energy: -28.268 flat angles P-C4'-P energy: -14.845 tors. eta vs tors. theta energy: -29.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 15 Temperature: 0.950000 Total energy: -378.394870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.394870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.394870 (E_RNA) where: Base-Base interactions energy: -248.191 where: short stacking energy: -102.626 Base-Backbone interact. energy: 0.488 local terms energy: -130.692044 where: bonds (distance) C4'-P energy: -30.054 bonds (distance) P-C4' energy: -27.673 flat angles C4'-P-C4' energy: -29.811 flat angles P-C4'-P energy: -15.833 tors. eta vs tors. theta energy: -27.320 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 15 Temperature: 1.000000 Total energy: -348.707775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -348.707775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -348.707775 (E_RNA) where: Base-Base interactions energy: -217.793 where: short stacking energy: -108.688 Base-Backbone interact. energy: -0.202 local terms energy: -130.712180 where: bonds (distance) C4'-P energy: -24.811 bonds (distance) P-C4' energy: -30.852 flat angles C4'-P-C4' energy: -27.876 flat angles P-C4'-P energy: -21.156 tors. eta vs tors. theta energy: -26.017 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 15 Temperature: 1.050000 Total energy: -379.870605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.870605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.870605 (E_RNA) where: Base-Base interactions energy: -249.553 where: short stacking energy: -134.945 Base-Backbone interact. energy: -0.079 local terms energy: -130.239010 where: bonds (distance) C4'-P energy: -25.741 bonds (distance) P-C4' energy: -20.046 flat angles C4'-P-C4' energy: -27.694 flat angles P-C4'-P energy: -21.040 tors. eta vs tors. theta energy: -35.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 15 Temperature: 1.100000 Total energy: -292.657201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.657201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.657201 (E_RNA) where: Base-Base interactions energy: -171.755 where: short stacking energy: -89.120 Base-Backbone interact. energy: -0.358 local terms energy: -120.544641 where: bonds (distance) C4'-P energy: -25.776 bonds (distance) P-C4' energy: -25.947 flat angles C4'-P-C4' energy: -30.432 flat angles P-C4'-P energy: -16.334 tors. eta vs tors. theta energy: -22.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 15 Temperature: 1.150000 Total energy: -275.132975 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.132975 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.132975 (E_RNA) where: Base-Base interactions energy: -167.022 where: short stacking energy: -87.516 Base-Backbone interact. energy: -0.236 local terms energy: -107.874447 where: bonds (distance) C4'-P energy: -25.337 bonds (distance) P-C4' energy: -26.614 flat angles C4'-P-C4' energy: -24.237 flat angles P-C4'-P energy: -11.620 tors. eta vs tors. theta energy: -20.066 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 15 Temperature: 1.200000 Total energy: -308.483861 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -308.483861 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -308.483861 (E_RNA) where: Base-Base interactions energy: -189.947 where: short stacking energy: -87.861 Base-Backbone interact. energy: -0.551 local terms energy: -117.986546 where: bonds (distance) C4'-P energy: -28.774 bonds (distance) P-C4' energy: -22.758 flat angles C4'-P-C4' energy: -22.524 flat angles P-C4'-P energy: -20.511 tors. eta vs tors. theta energy: -23.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 15 Temperature: 1.250000 Total energy: -173.547157 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -173.547157 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -173.547157 (E_RNA) where: Base-Base interactions energy: -80.591 where: short stacking energy: -42.074 Base-Backbone interact. energy: -0.520 local terms energy: -92.436152 where: bonds (distance) C4'-P energy: -25.105 bonds (distance) P-C4' energy: -29.251 flat angles C4'-P-C4' energy: -23.323 flat angles P-C4'-P energy: -13.199 tors. eta vs tors. theta energy: -1.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 15 Temperature: 1.300000 Total energy: -218.947015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.947015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.947015 (E_RNA) where: Base-Base interactions energy: -131.170 where: short stacking energy: -71.546 Base-Backbone interact. energy: -0.942 local terms energy: -86.835590 where: bonds (distance) C4'-P energy: -25.875 bonds (distance) P-C4' energy: -18.964 flat angles C4'-P-C4' energy: -20.496 flat angles P-C4'-P energy: -13.013 tors. eta vs tors. theta energy: -8.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 15 Temperature: 1.350000 Total energy: -207.261737 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -207.261737 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -207.261737 (E_RNA) where: Base-Base interactions energy: -123.864 where: short stacking energy: -45.805 Base-Backbone interact. energy: -0.348 local terms energy: -83.050382 where: bonds (distance) C4'-P energy: -22.457 bonds (distance) P-C4' energy: -21.844 flat angles C4'-P-C4' energy: -28.688 flat angles P-C4'-P energy: -8.138 tors. eta vs tors. theta energy: -1.924 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 16 Temperature: 0.900000 Total energy: -400.782637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.782637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.782637 (E_RNA) where: Base-Base interactions energy: -264.144 where: short stacking energy: -114.871 Base-Backbone interact. energy: -1.259 local terms energy: -135.379145 where: bonds (distance) C4'-P energy: -27.106 bonds (distance) P-C4' energy: -30.319 flat angles C4'-P-C4' energy: -27.985 flat angles P-C4'-P energy: -19.194 tors. eta vs tors. theta energy: -30.775 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 16 Temperature: 0.950000 Total energy: -384.895967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.895967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.895967 (E_RNA) where: Base-Base interactions energy: -261.498 where: short stacking energy: -120.947 Base-Backbone interact. energy: -2.545 local terms energy: -120.853146 where: bonds (distance) C4'-P energy: -22.027 bonds (distance) P-C4' energy: -25.200 flat angles C4'-P-C4' energy: -27.419 flat angles P-C4'-P energy: -19.875 tors. eta vs tors. theta energy: -26.332 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 16 Temperature: 1.000000 Total energy: -368.889504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.889504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.889504 (E_RNA) where: Base-Base interactions energy: -246.785 where: short stacking energy: -123.277 Base-Backbone interact. energy: 1.611 local terms energy: -123.715282 where: bonds (distance) C4'-P energy: -26.871 bonds (distance) P-C4' energy: -23.439 flat angles C4'-P-C4' energy: -24.281 flat angles P-C4'-P energy: -17.906 tors. eta vs tors. theta energy: -31.218 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 16 Temperature: 1.050000 Total energy: -320.706408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -320.706408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -320.706408 (E_RNA) where: Base-Base interactions energy: -202.437 where: short stacking energy: -112.947 Base-Backbone interact. energy: -0.199 local terms energy: -118.070350 where: bonds (distance) C4'-P energy: -23.131 bonds (distance) P-C4' energy: -21.857 flat angles C4'-P-C4' energy: -28.427 flat angles P-C4'-P energy: -19.786 tors. eta vs tors. theta energy: -24.870 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 16 Temperature: 1.100000 Total energy: -293.147053 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.147053 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.147053 (E_RNA) where: Base-Base interactions energy: -181.135 where: short stacking energy: -104.592 Base-Backbone interact. energy: 0.044 local terms energy: -112.055927 where: bonds (distance) C4'-P energy: -24.837 bonds (distance) P-C4' energy: -22.172 flat angles C4'-P-C4' energy: -26.983 flat angles P-C4'-P energy: -13.533 tors. eta vs tors. theta energy: -24.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 16 Temperature: 1.150000 Total energy: -273.269498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.269498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.269498 (E_RNA) where: Base-Base interactions energy: -184.567 where: short stacking energy: -76.222 Base-Backbone interact. energy: 1.504 local terms energy: -90.206360 where: bonds (distance) C4'-P energy: -26.170 bonds (distance) P-C4' energy: -23.775 flat angles C4'-P-C4' energy: -24.783 flat angles P-C4'-P energy: -7.112 tors. eta vs tors. theta energy: -8.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 16 Temperature: 1.200000 Total energy: -275.738490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.738490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.738490 (E_RNA) where: Base-Base interactions energy: -183.253 where: short stacking energy: -98.482 Base-Backbone interact. energy: -0.663 local terms energy: -91.822672 where: bonds (distance) C4'-P energy: -18.291 bonds (distance) P-C4' energy: -21.099 flat angles C4'-P-C4' energy: -19.197 flat angles P-C4'-P energy: -13.249 tors. eta vs tors. theta energy: -19.986 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 16 Temperature: 1.250000 Total energy: -229.913191 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.913191 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.913191 (E_RNA) where: Base-Base interactions energy: -129.002 where: short stacking energy: -73.167 Base-Backbone interact. energy: 0.685 local terms energy: -101.596258 where: bonds (distance) C4'-P energy: -17.711 bonds (distance) P-C4' energy: -29.206 flat angles C4'-P-C4' energy: -24.375 flat angles P-C4'-P energy: -17.785 tors. eta vs tors. theta energy: -12.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 16 Temperature: 1.300000 Total energy: -148.470685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.470685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.470685 (E_RNA) where: Base-Base interactions energy: -59.407 where: short stacking energy: -42.580 Base-Backbone interact. energy: -1.261 local terms energy: -87.802534 where: bonds (distance) C4'-P energy: -23.343 bonds (distance) P-C4' energy: -28.458 flat angles C4'-P-C4' energy: -18.940 flat angles P-C4'-P energy: -14.666 tors. eta vs tors. theta energy: -2.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 16 Temperature: 1.350000 Total energy: -230.817278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.817278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.817278 (E_RNA) where: Base-Base interactions energy: -154.115 where: short stacking energy: -71.181 Base-Backbone interact. energy: -1.537 local terms energy: -75.165590 where: bonds (distance) C4'-P energy: -14.696 bonds (distance) P-C4' energy: -18.962 flat angles C4'-P-C4' energy: -20.865 flat angles P-C4'-P energy: -7.869 tors. eta vs tors. theta energy: -12.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 17 Temperature: 0.900000 Total energy: -399.767597 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.767597 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.767597 (E_RNA) where: Base-Base interactions energy: -271.377 where: short stacking energy: -126.422 Base-Backbone interact. energy: -0.807 local terms energy: -127.583787 where: bonds (distance) C4'-P energy: -29.510 bonds (distance) P-C4' energy: -24.354 flat angles C4'-P-C4' energy: -27.753 flat angles P-C4'-P energy: -17.147 tors. eta vs tors. theta energy: -28.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 17 Temperature: 0.950000 Total energy: -372.421014 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.421014 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.421014 (E_RNA) where: Base-Base interactions energy: -239.008 where: short stacking energy: -130.424 Base-Backbone interact. energy: 0.070 local terms energy: -133.482711 where: bonds (distance) C4'-P energy: -28.218 bonds (distance) P-C4' energy: -25.498 flat angles C4'-P-C4' energy: -28.413 flat angles P-C4'-P energy: -15.284 tors. eta vs tors. theta energy: -36.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 17 Temperature: 1.000000 Total energy: -379.409463 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.409463 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.409463 (E_RNA) where: Base-Base interactions energy: -247.201 where: short stacking energy: -121.000 Base-Backbone interact. energy: -2.333 local terms energy: -129.875721 where: bonds (distance) C4'-P energy: -23.874 bonds (distance) P-C4' energy: -27.195 flat angles C4'-P-C4' energy: -27.644 flat angles P-C4'-P energy: -15.439 tors. eta vs tors. theta energy: -35.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 17 Temperature: 1.050000 Total energy: -333.609666 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -333.609666 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -333.609666 (E_RNA) where: Base-Base interactions energy: -214.511 where: short stacking energy: -99.026 Base-Backbone interact. energy: -1.021 local terms energy: -118.077094 where: bonds (distance) C4'-P energy: -24.698 bonds (distance) P-C4' energy: -30.672 flat angles C4'-P-C4' energy: -24.665 flat angles P-C4'-P energy: -17.519 tors. eta vs tors. theta energy: -20.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 17 Temperature: 1.100000 Total energy: -286.015517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.015517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.015517 (E_RNA) where: Base-Base interactions energy: -172.270 where: short stacking energy: -96.306 Base-Backbone interact. energy: 0.219 local terms energy: -113.964227 where: bonds (distance) C4'-P energy: -29.101 bonds (distance) P-C4' energy: -26.303 flat angles C4'-P-C4' energy: -22.414 flat angles P-C4'-P energy: -16.852 tors. eta vs tors. theta energy: -19.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 17 Temperature: 1.150000 Total energy: -269.350760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.350760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.350760 (E_RNA) where: Base-Base interactions energy: -174.091 where: short stacking energy: -98.593 Base-Backbone interact. energy: 4.140 local terms energy: -99.400000 where: bonds (distance) C4'-P energy: -17.425 bonds (distance) P-C4' energy: -26.931 flat angles C4'-P-C4' energy: -26.741 flat angles P-C4'-P energy: -12.155 tors. eta vs tors. theta energy: -16.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 17 Temperature: 1.200000 Total energy: -275.180898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.180898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.180898 (E_RNA) where: Base-Base interactions energy: -169.917 where: short stacking energy: -91.781 Base-Backbone interact. energy: -0.140 local terms energy: -105.124520 where: bonds (distance) C4'-P energy: -21.609 bonds (distance) P-C4' energy: -17.614 flat angles C4'-P-C4' energy: -22.649 flat angles P-C4'-P energy: -15.286 tors. eta vs tors. theta energy: -27.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 17 Temperature: 1.250000 Total energy: -230.398305 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.398305 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.398305 (E_RNA) where: Base-Base interactions energy: -143.079 where: short stacking energy: -75.159 Base-Backbone interact. energy: -0.340 local terms energy: -86.979470 where: bonds (distance) C4'-P energy: -19.475 bonds (distance) P-C4' energy: -24.657 flat angles C4'-P-C4' energy: -23.317 flat angles P-C4'-P energy: -9.208 tors. eta vs tors. theta energy: -10.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 17 Temperature: 1.300000 Total energy: -179.050077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -179.050077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -179.050077 (E_RNA) where: Base-Base interactions energy: -85.998 where: short stacking energy: -61.470 Base-Backbone interact. energy: -0.249 local terms energy: -92.803157 where: bonds (distance) C4'-P energy: -13.452 bonds (distance) P-C4' energy: -28.156 flat angles C4'-P-C4' energy: -22.718 flat angles P-C4'-P energy: -21.456 tors. eta vs tors. theta energy: -7.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 17 Temperature: 1.350000 Total energy: -236.652940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.652940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.652940 (E_RNA) where: Base-Base interactions energy: -134.123 where: short stacking energy: -73.942 Base-Backbone interact. energy: -0.472 local terms energy: -102.058183 where: bonds (distance) C4'-P energy: -23.523 bonds (distance) P-C4' energy: -17.984 flat angles C4'-P-C4' energy: -30.610 flat angles P-C4'-P energy: -15.872 tors. eta vs tors. theta energy: -14.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 18 Temperature: 0.900000 Total energy: -377.559085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.559085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.559085 (E_RNA) where: Base-Base interactions energy: -243.431 where: short stacking energy: -118.336 Base-Backbone interact. energy: -1.577 local terms energy: -132.550469 where: bonds (distance) C4'-P energy: -25.998 bonds (distance) P-C4' energy: -26.516 flat angles C4'-P-C4' energy: -24.781 flat angles P-C4'-P energy: -22.392 tors. eta vs tors. theta energy: -32.864 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 18 Temperature: 0.950000 Total energy: -381.866538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.866538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.866538 (E_RNA) where: Base-Base interactions energy: -258.016 where: short stacking energy: -134.331 Base-Backbone interact. energy: -0.668 local terms energy: -123.182465 where: bonds (distance) C4'-P energy: -25.257 bonds (distance) P-C4' energy: -27.897 flat angles C4'-P-C4' energy: -22.301 flat angles P-C4'-P energy: -17.983 tors. eta vs tors. theta energy: -29.744 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 18 Temperature: 1.000000 Total energy: -384.007243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -384.007243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -384.007243 (E_RNA) where: Base-Base interactions energy: -258.949 where: short stacking energy: -115.793 Base-Backbone interact. energy: -0.923 local terms energy: -124.134866 where: bonds (distance) C4'-P energy: -25.336 bonds (distance) P-C4' energy: -23.191 flat angles C4'-P-C4' energy: -27.329 flat angles P-C4'-P energy: -21.362 tors. eta vs tors. theta energy: -26.917 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 18 Temperature: 1.050000 Total energy: -330.930404 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.930404 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.930404 (E_RNA) where: Base-Base interactions energy: -222.679 where: short stacking energy: -109.154 Base-Backbone interact. energy: 1.126 local terms energy: -109.377977 where: bonds (distance) C4'-P energy: -23.088 bonds (distance) P-C4' energy: -24.730 flat angles C4'-P-C4' energy: -24.298 flat angles P-C4'-P energy: -15.706 tors. eta vs tors. theta energy: -21.557 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 18 Temperature: 1.100000 Total energy: -298.861688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.861688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.861688 (E_RNA) where: Base-Base interactions energy: -190.003 where: short stacking energy: -101.106 Base-Backbone interact. energy: -0.668 local terms energy: -108.190896 where: bonds (distance) C4'-P energy: -20.263 bonds (distance) P-C4' energy: -26.715 flat angles C4'-P-C4' energy: -21.414 flat angles P-C4'-P energy: -15.631 tors. eta vs tors. theta energy: -24.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 18 Temperature: 1.150000 Total energy: -267.465589 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -267.465589 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -267.465589 (E_RNA) where: Base-Base interactions energy: -166.279 where: short stacking energy: -86.299 Base-Backbone interact. energy: -1.002 local terms energy: -100.185371 where: bonds (distance) C4'-P energy: -23.826 bonds (distance) P-C4' energy: -28.129 flat angles C4'-P-C4' energy: -18.824 flat angles P-C4'-P energy: -16.912 tors. eta vs tors. theta energy: -12.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 18 Temperature: 1.200000 Total energy: -269.031804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.031804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.031804 (E_RNA) where: Base-Base interactions energy: -154.509 where: short stacking energy: -86.458 Base-Backbone interact. energy: -0.393 local terms energy: -114.129212 where: bonds (distance) C4'-P energy: -24.378 bonds (distance) P-C4' energy: -27.942 flat angles C4'-P-C4' energy: -27.664 flat angles P-C4'-P energy: -15.524 tors. eta vs tors. theta energy: -18.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 18 Temperature: 1.250000 Total energy: -235.094546 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.094546 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.094546 (E_RNA) where: Base-Base interactions energy: -128.326 where: short stacking energy: -59.343 Base-Backbone interact. energy: -0.496 local terms energy: -106.272500 where: bonds (distance) C4'-P energy: -23.784 bonds (distance) P-C4' energy: -25.542 flat angles C4'-P-C4' energy: -26.483 flat angles P-C4'-P energy: -18.062 tors. eta vs tors. theta energy: -12.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 18 Temperature: 1.300000 Total energy: -231.004692 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.004692 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.004692 (E_RNA) where: Base-Base interactions energy: -129.669 where: short stacking energy: -77.950 Base-Backbone interact. energy: -0.700 local terms energy: -100.635887 where: bonds (distance) C4'-P energy: -22.712 bonds (distance) P-C4' energy: -22.189 flat angles C4'-P-C4' energy: -23.251 flat angles P-C4'-P energy: -16.360 tors. eta vs tors. theta energy: -16.124 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 18 Temperature: 1.350000 Total energy: -158.284820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -158.284820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -158.284820 (E_RNA) where: Base-Base interactions energy: -74.288 where: short stacking energy: -46.035 Base-Backbone interact. energy: -0.279 local terms energy: -83.718038 where: bonds (distance) C4'-P energy: -16.185 bonds (distance) P-C4' energy: -28.616 flat angles C4'-P-C4' energy: -20.139 flat angles P-C4'-P energy: -14.438 tors. eta vs tors. theta energy: -4.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 19 Temperature: 0.900000 Total energy: -401.326598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.326598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.326598 (E_RNA) where: Base-Base interactions energy: -264.089 where: short stacking energy: -121.948 Base-Backbone interact. energy: 0.298 local terms energy: -137.535624 where: bonds (distance) C4'-P energy: -24.570 bonds (distance) P-C4' energy: -30.746 flat angles C4'-P-C4' energy: -29.577 flat angles P-C4'-P energy: -19.829 tors. eta vs tors. theta energy: -32.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 19 Temperature: 0.950000 Total energy: -399.262613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.262613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.262613 (E_RNA) where: Base-Base interactions energy: -276.270 where: short stacking energy: -125.741 Base-Backbone interact. energy: -1.876 local terms energy: -121.116967 where: bonds (distance) C4'-P energy: -24.760 bonds (distance) P-C4' energy: -25.807 flat angles C4'-P-C4' energy: -26.161 flat angles P-C4'-P energy: -15.908 tors. eta vs tors. theta energy: -28.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 19 Temperature: 1.000000 Total energy: -382.099940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.099940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.099940 (E_RNA) where: Base-Base interactions energy: -257.044 where: short stacking energy: -126.209 Base-Backbone interact. energy: 1.008 local terms energy: -126.063774 where: bonds (distance) C4'-P energy: -23.821 bonds (distance) P-C4' energy: -27.168 flat angles C4'-P-C4' energy: -23.382 flat angles P-C4'-P energy: -18.895 tors. eta vs tors. theta energy: -32.798 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 19 Temperature: 1.050000 Total energy: -345.403445 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.403445 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.403445 (E_RNA) where: Base-Base interactions energy: -221.930 where: short stacking energy: -114.986 Base-Backbone interact. energy: -1.820 local terms energy: -121.653062 where: bonds (distance) C4'-P energy: -18.237 bonds (distance) P-C4' energy: -29.838 flat angles C4'-P-C4' energy: -27.720 flat angles P-C4'-P energy: -16.660 tors. eta vs tors. theta energy: -29.198 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 19 Temperature: 1.100000 Total energy: -283.348006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.348006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.348006 (E_RNA) where: Base-Base interactions energy: -178.747 where: short stacking energy: -101.339 Base-Backbone interact. energy: -0.088 local terms energy: -104.513670 where: bonds (distance) C4'-P energy: -20.170 bonds (distance) P-C4' energy: -19.208 flat angles C4'-P-C4' energy: -29.406 flat angles P-C4'-P energy: -12.449 tors. eta vs tors. theta energy: -23.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 19 Temperature: 1.150000 Total energy: -268.743913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.743913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.743913 (E_RNA) where: Base-Base interactions energy: -163.162 where: short stacking energy: -88.093 Base-Backbone interact. energy: -0.760 local terms energy: -104.822674 where: bonds (distance) C4'-P energy: -18.999 bonds (distance) P-C4' energy: -26.079 flat angles C4'-P-C4' energy: -24.494 flat angles P-C4'-P energy: -15.454 tors. eta vs tors. theta energy: -19.797 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 19 Temperature: 1.200000 Total energy: -258.319581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.319581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.319581 (E_RNA) where: Base-Base interactions energy: -162.503 where: short stacking energy: -91.148 Base-Backbone interact. energy: 0.809 local terms energy: -96.625963 where: bonds (distance) C4'-P energy: -21.374 bonds (distance) P-C4' energy: -25.148 flat angles C4'-P-C4' energy: -26.010 flat angles P-C4'-P energy: -12.925 tors. eta vs tors. theta energy: -11.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 19 Temperature: 1.250000 Total energy: -255.385540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.385540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.385540 (E_RNA) where: Base-Base interactions energy: -161.758 where: short stacking energy: -83.596 Base-Backbone interact. energy: -0.131 local terms energy: -93.496592 where: bonds (distance) C4'-P energy: -21.953 bonds (distance) P-C4' energy: -20.147 flat angles C4'-P-C4' energy: -25.147 flat angles P-C4'-P energy: -9.755 tors. eta vs tors. theta energy: -16.494 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 19 Temperature: 1.300000 Total energy: -232.683738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.683738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.683738 (E_RNA) where: Base-Base interactions energy: -145.928 where: short stacking energy: -73.038 Base-Backbone interact. energy: -0.745 local terms energy: -86.010805 where: bonds (distance) C4'-P energy: -19.937 bonds (distance) P-C4' energy: -19.311 flat angles C4'-P-C4' energy: -22.718 flat angles P-C4'-P energy: -12.317 tors. eta vs tors. theta energy: -11.728 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 19 Temperature: 1.350000 Total energy: -189.013941 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -189.013941 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -189.013941 (E_RNA) where: Base-Base interactions energy: -106.410 where: short stacking energy: -56.970 Base-Backbone interact. energy: -0.917 local terms energy: -81.686295 where: bonds (distance) C4'-P energy: -11.598 bonds (distance) P-C4' energy: -26.123 flat angles C4'-P-C4' energy: -25.017 flat angles P-C4'-P energy: -13.983 tors. eta vs tors. theta energy: -4.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 20 Temperature: 0.900000 Total energy: -400.844079 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.844079 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.844079 (E_RNA) where: Base-Base interactions energy: -273.958 where: short stacking energy: -126.177 Base-Backbone interact. energy: -2.409 local terms energy: -124.477671 where: bonds (distance) C4'-P energy: -23.295 bonds (distance) P-C4' energy: -27.129 flat angles C4'-P-C4' energy: -27.733 flat angles P-C4'-P energy: -12.374 tors. eta vs tors. theta energy: -33.947 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 20 Temperature: 0.950000 Total energy: -398.879082 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.879082 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.879082 (E_RNA) where: Base-Base interactions energy: -259.250 where: short stacking energy: -134.222 Base-Backbone interact. energy: -0.286 local terms energy: -139.343133 where: bonds (distance) C4'-P energy: -26.099 bonds (distance) P-C4' energy: -27.085 flat angles C4'-P-C4' energy: -29.786 flat angles P-C4'-P energy: -21.384 tors. eta vs tors. theta energy: -34.989 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 20 Temperature: 1.000000 Total energy: -354.850276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -354.850276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -354.850276 (E_RNA) where: Base-Base interactions energy: -247.238 where: short stacking energy: -109.629 Base-Backbone interact. energy: -1.045 local terms energy: -106.567502 where: bonds (distance) C4'-P energy: -19.086 bonds (distance) P-C4' energy: -24.937 flat angles C4'-P-C4' energy: -28.216 flat angles P-C4'-P energy: -14.757 tors. eta vs tors. theta energy: -19.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 20 Temperature: 1.050000 Total energy: -382.736105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.736105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.736105 (E_RNA) where: Base-Base interactions energy: -242.033 where: short stacking energy: -120.132 Base-Backbone interact. energy: -1.675 local terms energy: -139.028359 where: bonds (distance) C4'-P energy: -28.205 bonds (distance) P-C4' energy: -28.266 flat angles C4'-P-C4' energy: -26.215 flat angles P-C4'-P energy: -20.758 tors. eta vs tors. theta energy: -35.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 20 Temperature: 1.100000 Total energy: -290.847255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -290.847255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -290.847255 (E_RNA) where: Base-Base interactions energy: -178.175 where: short stacking energy: -102.696 Base-Backbone interact. energy: 1.376 local terms energy: -114.048623 where: bonds (distance) C4'-P energy: -26.353 bonds (distance) P-C4' energy: -23.040 flat angles C4'-P-C4' energy: -23.499 flat angles P-C4'-P energy: -17.139 tors. eta vs tors. theta energy: -24.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 20 Temperature: 1.150000 Total energy: -250.920685 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.920685 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.920685 (E_RNA) where: Base-Base interactions energy: -150.786 where: short stacking energy: -80.634 Base-Backbone interact. energy: -0.971 local terms energy: -99.164088 where: bonds (distance) C4'-P energy: -24.398 bonds (distance) P-C4' energy: -29.900 flat angles C4'-P-C4' energy: -22.083 flat angles P-C4'-P energy: -12.528 tors. eta vs tors. theta energy: -10.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 1 ===================================== Write number: 20 Temperature: 1.200000 Total energy: -280.369043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.369043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.369043 (E_RNA) where: Base-Base interactions energy: -180.309 where: short stacking energy: -88.898 Base-Backbone interact. energy: -0.252 local terms energy: -99.807987 where: bonds (distance) C4'-P energy: -22.388 bonds (distance) P-C4' energy: -21.173 flat angles C4'-P-C4' energy: -28.124 flat angles P-C4'-P energy: -13.955 tors. eta vs tors. theta energy: -14.168 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 20 Temperature: 1.250000 Total energy: -224.064544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.064544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.064544 (E_RNA) where: Base-Base interactions energy: -131.598 where: short stacking energy: -73.279 Base-Backbone interact. energy: 1.388 local terms energy: -93.854718 where: bonds (distance) C4'-P energy: -24.125 bonds (distance) P-C4' energy: -23.926 flat angles C4'-P-C4' energy: -17.271 flat angles P-C4'-P energy: -17.685 tors. eta vs tors. theta energy: -10.848 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 20 Temperature: 1.300000 Total energy: -218.175167 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.175167 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.175167 (E_RNA) where: Base-Base interactions energy: -119.998 where: short stacking energy: -63.422 Base-Backbone interact. energy: -0.485 local terms energy: -97.692018 where: bonds (distance) C4'-P energy: -27.286 bonds (distance) P-C4' energy: -29.062 flat angles C4'-P-C4' energy: -21.492 flat angles P-C4'-P energy: -13.673 tors. eta vs tors. theta energy: -6.180 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 20 Temperature: 1.350000 Total energy: -212.690128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.690128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.690128 (E_RNA) where: Base-Base interactions energy: -127.561 where: short stacking energy: -64.939 Base-Backbone interact. energy: 0.292 local terms energy: -85.421204 where: bonds (distance) C4'-P energy: -24.359 bonds (distance) P-C4' energy: -16.241 flat angles C4'-P-C4' energy: -24.631 flat angles P-C4'-P energy: -11.961 tors. eta vs tors. theta energy: -8.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 6 ===================================== Write number: 21 Temperature: 0.900000 Total energy: -399.931657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.931657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.931657 (E_RNA) where: Base-Base interactions energy: -269.271 where: short stacking energy: -113.505 Base-Backbone interact. energy: 2.289 local terms energy: -132.949894 where: bonds (distance) C4'-P energy: -26.411 bonds (distance) P-C4' energy: -25.871 flat angles C4'-P-C4' energy: -28.159 flat angles P-C4'-P energy: -23.386 tors. eta vs tors. theta energy: -29.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 21 Temperature: 0.950000 Total energy: -364.061005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.061005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.061005 (E_RNA) where: Base-Base interactions energy: -246.965 where: short stacking energy: -117.471 Base-Backbone interact. energy: -1.095 local terms energy: -116.000945 where: bonds (distance) C4'-P energy: -22.488 bonds (distance) P-C4' energy: -23.261 flat angles C4'-P-C4' energy: -27.933 flat angles P-C4'-P energy: -18.130 tors. eta vs tors. theta energy: -24.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 21 Temperature: 1.000000 Total energy: -409.842563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.842563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.842563 (E_RNA) where: Base-Base interactions energy: -272.441 where: short stacking energy: -125.532 Base-Backbone interact. energy: -1.059 local terms energy: -136.341951 where: bonds (distance) C4'-P energy: -24.048 bonds (distance) P-C4' energy: -23.351 flat angles C4'-P-C4' energy: -31.485 flat angles P-C4'-P energy: -18.599 tors. eta vs tors. theta energy: -38.859 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 21 Temperature: 1.050000 Total energy: -389.600405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.600405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.600405 (E_RNA) where: Base-Base interactions energy: -263.813 where: short stacking energy: -128.966 Base-Backbone interact. energy: -2.373 local terms energy: -123.413943 where: bonds (distance) C4'-P energy: -18.457 bonds (distance) P-C4' energy: -22.391 flat angles C4'-P-C4' energy: -27.450 flat angles P-C4'-P energy: -17.231 tors. eta vs tors. theta energy: -37.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 21 Temperature: 1.100000 Total energy: -277.468115 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -277.468115 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -277.468115 (E_RNA) where: Base-Base interactions energy: -164.082 where: short stacking energy: -99.885 Base-Backbone interact. energy: 0.304 local terms energy: -113.690450 where: bonds (distance) C4'-P energy: -22.475 bonds (distance) P-C4' energy: -25.955 flat angles C4'-P-C4' energy: -28.620 flat angles P-C4'-P energy: -16.023 tors. eta vs tors. theta energy: -20.618 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 21 Temperature: 1.150000 Total energy: -266.884665 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.884665 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.884665 (E_RNA) where: Base-Base interactions energy: -174.572 where: short stacking energy: -85.793 Base-Backbone interact. energy: -0.283 local terms energy: -92.029157 where: bonds (distance) C4'-P energy: -17.641 bonds (distance) P-C4' energy: -19.359 flat angles C4'-P-C4' energy: -27.488 flat angles P-C4'-P energy: -9.419 tors. eta vs tors. theta energy: -18.122 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 21 Temperature: 1.200000 Total energy: -243.833475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.833475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.833475 (E_RNA) where: Base-Base interactions energy: -157.530 where: short stacking energy: -83.266 Base-Backbone interact. energy: -0.279 local terms energy: -86.024223 where: bonds (distance) C4'-P energy: -19.925 bonds (distance) P-C4' energy: -19.278 flat angles C4'-P-C4' energy: -21.996 flat angles P-C4'-P energy: -12.215 tors. eta vs tors. theta energy: -12.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 21 Temperature: 1.250000 Total energy: -242.407642 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.407642 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.407642 (E_RNA) where: Base-Base interactions energy: -149.547 where: short stacking energy: -84.693 Base-Backbone interact. energy: -0.809 local terms energy: -92.051574 where: bonds (distance) C4'-P energy: -24.578 bonds (distance) P-C4' energy: -25.710 flat angles C4'-P-C4' energy: -19.281 flat angles P-C4'-P energy: -7.908 tors. eta vs tors. theta energy: -14.574 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 21 Temperature: 1.300000 Total energy: -226.498877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.498877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.498877 (E_RNA) where: Base-Base interactions energy: -132.597 where: short stacking energy: -63.431 Base-Backbone interact. energy: -0.362 local terms energy: -93.539409 where: bonds (distance) C4'-P energy: -19.973 bonds (distance) P-C4' energy: -21.896 flat angles C4'-P-C4' energy: -24.487 flat angles P-C4'-P energy: -13.058 tors. eta vs tors. theta energy: -14.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 21 Temperature: 1.350000 Total energy: -220.216578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.216578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.216578 (E_RNA) where: Base-Base interactions energy: -127.070 where: short stacking energy: -69.590 Base-Backbone interact. energy: -0.253 local terms energy: -92.894475 where: bonds (distance) C4'-P energy: -20.991 bonds (distance) P-C4' energy: -21.317 flat angles C4'-P-C4' energy: -27.442 flat angles P-C4'-P energy: -14.483 tors. eta vs tors. theta energy: -8.663 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 22 Temperature: 0.900000 Total energy: -380.002419 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.002419 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.002419 (E_RNA) where: Base-Base interactions energy: -254.257 where: short stacking energy: -113.110 Base-Backbone interact. energy: -1.198 local terms energy: -124.547687 where: bonds (distance) C4'-P energy: -25.039 bonds (distance) P-C4' energy: -28.957 flat angles C4'-P-C4' energy: -27.129 flat angles P-C4'-P energy: -21.641 tors. eta vs tors. theta energy: -21.782 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 22 Temperature: 0.950000 Total energy: -399.035111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.035111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.035111 (E_RNA) where: Base-Base interactions energy: -273.852 where: short stacking energy: -113.273 Base-Backbone interact. energy: -1.620 local terms energy: -123.563580 where: bonds (distance) C4'-P energy: -28.876 bonds (distance) P-C4' energy: -25.205 flat angles C4'-P-C4' energy: -28.291 flat angles P-C4'-P energy: -17.388 tors. eta vs tors. theta energy: -23.803 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 22 Temperature: 1.000000 Total energy: -400.014110 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.014110 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.014110 (E_RNA) where: Base-Base interactions energy: -261.400 where: short stacking energy: -131.120 Base-Backbone interact. energy: -3.731 local terms energy: -134.882839 where: bonds (distance) C4'-P energy: -23.236 bonds (distance) P-C4' energy: -25.350 flat angles C4'-P-C4' energy: -31.387 flat angles P-C4'-P energy: -23.607 tors. eta vs tors. theta energy: -31.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 22 Temperature: 1.050000 Total energy: -430.791217 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.791217 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.791217 (E_RNA) where: Base-Base interactions energy: -299.455 where: short stacking energy: -123.851 Base-Backbone interact. energy: -0.263 local terms energy: -131.073025 where: bonds (distance) C4'-P energy: -25.399 bonds (distance) P-C4' energy: -25.371 flat angles C4'-P-C4' energy: -26.882 flat angles P-C4'-P energy: -18.325 tors. eta vs tors. theta energy: -35.096 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 22 Temperature: 1.100000 Total energy: -279.156653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.156653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.156653 (E_RNA) where: Base-Base interactions energy: -164.592 where: short stacking energy: -95.675 Base-Backbone interact. energy: 0.407 local terms energy: -114.971834 where: bonds (distance) C4'-P energy: -26.407 bonds (distance) P-C4' energy: -27.702 flat angles C4'-P-C4' energy: -25.751 flat angles P-C4'-P energy: -12.878 tors. eta vs tors. theta energy: -22.234 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 22 Temperature: 1.150000 Total energy: -260.147094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.147094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.147094 (E_RNA) where: Base-Base interactions energy: -151.515 where: short stacking energy: -95.277 Base-Backbone interact. energy: 0.264 local terms energy: -108.895898 where: bonds (distance) C4'-P energy: -27.742 bonds (distance) P-C4' energy: -27.717 flat angles C4'-P-C4' energy: -25.869 flat angles P-C4'-P energy: -13.513 tors. eta vs tors. theta energy: -14.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 22 Temperature: 1.200000 Total energy: -257.478554 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.478554 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.478554 (E_RNA) where: Base-Base interactions energy: -156.757 where: short stacking energy: -84.514 Base-Backbone interact. energy: -0.459 local terms energy: -100.262422 where: bonds (distance) C4'-P energy: -22.405 bonds (distance) P-C4' energy: -29.858 flat angles C4'-P-C4' energy: -27.584 flat angles P-C4'-P energy: -8.692 tors. eta vs tors. theta energy: -11.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 22 Temperature: 1.250000 Total energy: -249.845241 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.845241 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.845241 (E_RNA) where: Base-Base interactions energy: -161.026 where: short stacking energy: -89.808 Base-Backbone interact. energy: 0.312 local terms energy: -89.131176 where: bonds (distance) C4'-P energy: -22.472 bonds (distance) P-C4' energy: -24.099 flat angles C4'-P-C4' energy: -18.758 flat angles P-C4'-P energy: -12.321 tors. eta vs tors. theta energy: -11.481 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 22 Temperature: 1.300000 Total energy: -222.715166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.715166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.715166 (E_RNA) where: Base-Base interactions energy: -133.008 where: short stacking energy: -83.268 Base-Backbone interact. energy: 0.651 local terms energy: -90.358347 where: bonds (distance) C4'-P energy: -12.135 bonds (distance) P-C4' energy: -23.179 flat angles C4'-P-C4' energy: -18.322 flat angles P-C4'-P energy: -15.856 tors. eta vs tors. theta energy: -20.867 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 22 Temperature: 1.350000 Total energy: -224.499673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.499673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.499673 (E_RNA) where: Base-Base interactions energy: -131.294 where: short stacking energy: -65.639 Base-Backbone interact. energy: -1.684 local terms energy: -91.522487 where: bonds (distance) C4'-P energy: -24.363 bonds (distance) P-C4' energy: -23.021 flat angles C4'-P-C4' energy: -17.218 flat angles P-C4'-P energy: -15.684 tors. eta vs tors. theta energy: -11.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 23 Temperature: 0.900000 Total energy: -381.209209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.209209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.209209 (E_RNA) where: Base-Base interactions energy: -252.406 where: short stacking energy: -118.798 Base-Backbone interact. energy: -0.727 local terms energy: -128.075825 where: bonds (distance) C4'-P energy: -23.320 bonds (distance) P-C4' energy: -28.386 flat angles C4'-P-C4' energy: -26.762 flat angles P-C4'-P energy: -23.965 tors. eta vs tors. theta energy: -25.643 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 23 Temperature: 0.950000 Total energy: -400.806441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.806441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.806441 (E_RNA) where: Base-Base interactions energy: -268.425 where: short stacking energy: -119.240 Base-Backbone interact. energy: -0.604 local terms energy: -131.777040 where: bonds (distance) C4'-P energy: -21.741 bonds (distance) P-C4' energy: -26.097 flat angles C4'-P-C4' energy: -29.067 flat angles P-C4'-P energy: -19.768 tors. eta vs tors. theta energy: -35.104 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 23 Temperature: 1.000000 Total energy: -391.173827 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.173827 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.173827 (E_RNA) where: Base-Base interactions energy: -266.510 where: short stacking energy: -113.326 Base-Backbone interact. energy: -0.776 local terms energy: -123.888316 where: bonds (distance) C4'-P energy: -29.013 bonds (distance) P-C4' energy: -26.722 flat angles C4'-P-C4' energy: -28.085 flat angles P-C4'-P energy: -16.358 tors. eta vs tors. theta energy: -23.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 23 Temperature: 1.050000 Total energy: -430.778781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.778781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.778781 (E_RNA) where: Base-Base interactions energy: -289.466 where: short stacking energy: -136.821 Base-Backbone interact. energy: -1.280 local terms energy: -140.033084 where: bonds (distance) C4'-P energy: -24.978 bonds (distance) P-C4' energy: -29.199 flat angles C4'-P-C4' energy: -26.340 flat angles P-C4'-P energy: -18.869 tors. eta vs tors. theta energy: -40.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 23 Temperature: 1.100000 Total energy: -262.282267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.282267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.282267 (E_RNA) where: Base-Base interactions energy: -148.535 where: short stacking energy: -81.712 Base-Backbone interact. energy: -0.995 local terms energy: -112.751525 where: bonds (distance) C4'-P energy: -25.505 bonds (distance) P-C4' energy: -21.212 flat angles C4'-P-C4' energy: -24.434 flat angles P-C4'-P energy: -19.482 tors. eta vs tors. theta energy: -22.118 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 23 Temperature: 1.150000 Total energy: -260.983049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.983049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.983049 (E_RNA) where: Base-Base interactions energy: -157.466 where: short stacking energy: -90.318 Base-Backbone interact. energy: -1.323 local terms energy: -102.194143 where: bonds (distance) C4'-P energy: -22.524 bonds (distance) P-C4' energy: -15.984 flat angles C4'-P-C4' energy: -24.373 flat angles P-C4'-P energy: -18.237 tors. eta vs tors. theta energy: -21.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 23 Temperature: 1.200000 Total energy: -266.380572 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.380572 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.380572 (E_RNA) where: Base-Base interactions energy: -170.381 where: short stacking energy: -76.593 Base-Backbone interact. energy: 1.641 local terms energy: -97.640622 where: bonds (distance) C4'-P energy: -21.285 bonds (distance) P-C4' energy: -24.546 flat angles C4'-P-C4' energy: -21.148 flat angles P-C4'-P energy: -16.661 tors. eta vs tors. theta energy: -14.001 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 23 Temperature: 1.250000 Total energy: -242.512860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.512860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.512860 (E_RNA) where: Base-Base interactions energy: -149.758 where: short stacking energy: -65.584 Base-Backbone interact. energy: -0.992 local terms energy: -91.762933 where: bonds (distance) C4'-P energy: -18.710 bonds (distance) P-C4' energy: -23.852 flat angles C4'-P-C4' energy: -24.151 flat angles P-C4'-P energy: -14.737 tors. eta vs tors. theta energy: -10.313 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 23 Temperature: 1.300000 Total energy: -234.241326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.241326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.241326 (E_RNA) where: Base-Base interactions energy: -135.607 where: short stacking energy: -62.464 Base-Backbone interact. energy: -0.815 local terms energy: -97.819695 where: bonds (distance) C4'-P energy: -16.553 bonds (distance) P-C4' energy: -26.269 flat angles C4'-P-C4' energy: -24.963 flat angles P-C4'-P energy: -14.960 tors. eta vs tors. theta energy: -15.074 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 23 Temperature: 1.350000 Total energy: -228.796937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.796937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.796937 (E_RNA) where: Base-Base interactions energy: -138.614 where: short stacking energy: -64.667 Base-Backbone interact. energy: -0.324 local terms energy: -89.858835 where: bonds (distance) C4'-P energy: -20.009 bonds (distance) P-C4' energy: -22.481 flat angles C4'-P-C4' energy: -21.440 flat angles P-C4'-P energy: -12.314 tors. eta vs tors. theta energy: -13.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 24 Temperature: 0.900000 Total energy: -411.200106 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.200106 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.200106 (E_RNA) where: Base-Base interactions energy: -286.807 where: short stacking energy: -128.557 Base-Backbone interact. energy: -0.349 local terms energy: -124.044166 where: bonds (distance) C4'-P energy: -27.869 bonds (distance) P-C4' energy: -27.365 flat angles C4'-P-C4' energy: -27.208 flat angles P-C4'-P energy: -11.854 tors. eta vs tors. theta energy: -29.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 24 Temperature: 0.950000 Total energy: -365.184633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.184633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.184633 (E_RNA) where: Base-Base interactions energy: -250.644 where: short stacking energy: -99.232 Base-Backbone interact. energy: -0.967 local terms energy: -113.574204 where: bonds (distance) C4'-P energy: -22.447 bonds (distance) P-C4' energy: -28.350 flat angles C4'-P-C4' energy: -26.619 flat angles P-C4'-P energy: -13.838 tors. eta vs tors. theta energy: -22.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 24 Temperature: 1.000000 Total energy: -442.833989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.833989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.833989 (E_RNA) where: Base-Base interactions energy: -309.415 where: short stacking energy: -143.101 Base-Backbone interact. energy: -0.500 local terms energy: -132.919543 where: bonds (distance) C4'-P energy: -24.965 bonds (distance) P-C4' energy: -23.289 flat angles C4'-P-C4' energy: -26.544 flat angles P-C4'-P energy: -16.725 tors. eta vs tors. theta energy: -41.396 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 24 Temperature: 1.050000 Total energy: -390.264061 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.264061 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.264061 (E_RNA) where: Base-Base interactions energy: -277.316 where: short stacking energy: -105.087 Base-Backbone interact. energy: 0.477 local terms energy: -113.425065 where: bonds (distance) C4'-P energy: -23.466 bonds (distance) P-C4' energy: -26.698 flat angles C4'-P-C4' energy: -21.072 flat angles P-C4'-P energy: -13.712 tors. eta vs tors. theta energy: -28.478 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 24 Temperature: 1.100000 Total energy: -286.892251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.892251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.892251 (E_RNA) where: Base-Base interactions energy: -182.465 where: short stacking energy: -107.700 Base-Backbone interact. energy: -1.131 local terms energy: -103.296649 where: bonds (distance) C4'-P energy: -25.118 bonds (distance) P-C4' energy: -16.088 flat angles C4'-P-C4' energy: -25.659 flat angles P-C4'-P energy: -14.756 tors. eta vs tors. theta energy: -21.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 24 Temperature: 1.150000 Total energy: -246.014797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.014797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.014797 (E_RNA) where: Base-Base interactions energy: -153.905 where: short stacking energy: -83.111 Base-Backbone interact. energy: -0.283 local terms energy: -91.826911 where: bonds (distance) C4'-P energy: -28.878 bonds (distance) P-C4' energy: -18.646 flat angles C4'-P-C4' energy: -18.341 flat angles P-C4'-P energy: -13.453 tors. eta vs tors. theta energy: -12.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 24 Temperature: 1.200000 Total energy: -264.951698 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.951698 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.951698 (E_RNA) where: Base-Base interactions energy: -161.440 where: short stacking energy: -91.270 Base-Backbone interact. energy: -0.753 local terms energy: -102.759358 where: bonds (distance) C4'-P energy: -28.404 bonds (distance) P-C4' energy: -25.250 flat angles C4'-P-C4' energy: -17.650 flat angles P-C4'-P energy: -14.071 tors. eta vs tors. theta energy: -17.384 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 24 Temperature: 1.250000 Total energy: -229.055490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.055490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.055490 (E_RNA) where: Base-Base interactions energy: -129.491 where: short stacking energy: -70.373 Base-Backbone interact. energy: -0.184 local terms energy: -99.380190 where: bonds (distance) C4'-P energy: -27.088 bonds (distance) P-C4' energy: -18.584 flat angles C4'-P-C4' energy: -22.608 flat angles P-C4'-P energy: -20.975 tors. eta vs tors. theta energy: -10.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 24 Temperature: 1.300000 Total energy: -216.985359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -216.985359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -216.985359 (E_RNA) where: Base-Base interactions energy: -130.386 where: short stacking energy: -77.253 Base-Backbone interact. energy: -0.080 local terms energy: -86.519965 where: bonds (distance) C4'-P energy: -15.330 bonds (distance) P-C4' energy: -24.608 flat angles C4'-P-C4' energy: -22.306 flat angles P-C4'-P energy: -7.235 tors. eta vs tors. theta energy: -17.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 24 Temperature: 1.350000 Total energy: -221.851006 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.851006 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.851006 (E_RNA) where: Base-Base interactions energy: -125.691 where: short stacking energy: -66.613 Base-Backbone interact. energy: -0.164 local terms energy: -95.996036 where: bonds (distance) C4'-P energy: -19.620 bonds (distance) P-C4' energy: -24.767 flat angles C4'-P-C4' energy: -19.257 flat angles P-C4'-P energy: -17.736 tors. eta vs tors. theta energy: -14.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 3 ===================================== Write number: 25 Temperature: 0.900000 Total energy: -418.614631 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.614631 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.614631 (E_RNA) where: Base-Base interactions energy: -289.638 where: short stacking energy: -132.238 Base-Backbone interact. energy: -0.719 local terms energy: -128.257319 where: bonds (distance) C4'-P energy: -22.118 bonds (distance) P-C4' energy: -25.507 flat angles C4'-P-C4' energy: -26.424 flat angles P-C4'-P energy: -22.600 tors. eta vs tors. theta energy: -31.608 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 25 Temperature: 0.950000 Total energy: -452.642362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.642362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.642362 (E_RNA) where: Base-Base interactions energy: -304.818 where: short stacking energy: -138.727 Base-Backbone interact. energy: -0.023 local terms energy: -147.801642 where: bonds (distance) C4'-P energy: -26.643 bonds (distance) P-C4' energy: -26.107 flat angles C4'-P-C4' energy: -29.630 flat angles P-C4'-P energy: -22.650 tors. eta vs tors. theta energy: -42.771 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 25 Temperature: 1.000000 Total energy: -350.382496 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.382496 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.382496 (E_RNA) where: Base-Base interactions energy: -231.449 where: short stacking energy: -115.355 Base-Backbone interact. energy: 7.740 local terms energy: -126.673751 where: bonds (distance) C4'-P energy: -25.391 bonds (distance) P-C4' energy: -29.435 flat angles C4'-P-C4' energy: -23.883 flat angles P-C4'-P energy: -19.936 tors. eta vs tors. theta energy: -28.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 25 Temperature: 1.050000 Total energy: -366.386636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.386636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.386636 (E_RNA) where: Base-Base interactions energy: -245.800 where: short stacking energy: -106.356 Base-Backbone interact. energy: -0.874 local terms energy: -119.712389 where: bonds (distance) C4'-P energy: -23.191 bonds (distance) P-C4' energy: -23.834 flat angles C4'-P-C4' energy: -29.236 flat angles P-C4'-P energy: -20.906 tors. eta vs tors. theta energy: -22.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 25 Temperature: 1.100000 Total energy: -292.136657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.136657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.136657 (E_RNA) where: Base-Base interactions energy: -187.829 where: short stacking energy: -99.126 Base-Backbone interact. energy: -0.735 local terms energy: -103.572578 where: bonds (distance) C4'-P energy: -25.767 bonds (distance) P-C4' energy: -25.258 flat angles C4'-P-C4' energy: -18.401 flat angles P-C4'-P energy: -17.045 tors. eta vs tors. theta energy: -17.102 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 25 Temperature: 1.150000 Total energy: -249.326156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.326156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.326156 (E_RNA) where: Base-Base interactions energy: -143.625 where: short stacking energy: -86.822 Base-Backbone interact. energy: 0.107 local terms energy: -105.808509 where: bonds (distance) C4'-P energy: -20.783 bonds (distance) P-C4' energy: -28.486 flat angles C4'-P-C4' energy: -25.163 flat angles P-C4'-P energy: -14.526 tors. eta vs tors. theta energy: -16.851 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 25 Temperature: 1.200000 Total energy: -251.239318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.239318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.239318 (E_RNA) where: Base-Base interactions energy: -140.424 where: short stacking energy: -85.398 Base-Backbone interact. energy: 0.081 local terms energy: -110.896500 where: bonds (distance) C4'-P energy: -24.757 bonds (distance) P-C4' energy: -28.766 flat angles C4'-P-C4' energy: -20.435 flat angles P-C4'-P energy: -14.747 tors. eta vs tors. theta energy: -22.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 25 Temperature: 1.250000 Total energy: -245.297232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.297232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.297232 (E_RNA) where: Base-Base interactions energy: -141.319 where: short stacking energy: -73.066 Base-Backbone interact. energy: 1.592 local terms energy: -105.570023 where: bonds (distance) C4'-P energy: -22.906 bonds (distance) P-C4' energy: -25.542 flat angles C4'-P-C4' energy: -26.383 flat angles P-C4'-P energy: -14.049 tors. eta vs tors. theta energy: -16.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 25 Temperature: 1.300000 Total energy: -214.902697 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.902697 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.902697 (E_RNA) where: Base-Base interactions energy: -124.841 where: short stacking energy: -70.521 Base-Backbone interact. energy: -0.571 local terms energy: -89.490655 where: bonds (distance) C4'-P energy: -17.708 bonds (distance) P-C4' energy: -28.039 flat angles C4'-P-C4' energy: -21.430 flat angles P-C4'-P energy: -17.704 tors. eta vs tors. theta energy: -4.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 25 Temperature: 1.350000 Total energy: -228.461078 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.461078 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.461078 (E_RNA) where: Base-Base interactions energy: -132.743 where: short stacking energy: -78.134 Base-Backbone interact. energy: -0.741 local terms energy: -94.977985 where: bonds (distance) C4'-P energy: -15.147 bonds (distance) P-C4' energy: -25.617 flat angles C4'-P-C4' energy: -22.845 flat angles P-C4'-P energy: -10.936 tors. eta vs tors. theta energy: -20.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 26 Temperature: 0.900000 Total energy: -460.387284 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.387284 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.387284 (E_RNA) where: Base-Base interactions energy: -319.869 where: short stacking energy: -141.758 Base-Backbone interact. energy: -0.009 local terms energy: -140.508968 where: bonds (distance) C4'-P energy: -19.652 bonds (distance) P-C4' energy: -27.204 flat angles C4'-P-C4' energy: -29.165 flat angles P-C4'-P energy: -20.788 tors. eta vs tors. theta energy: -43.700 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 26 Temperature: 0.950000 Total energy: -408.067353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.067353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.067353 (E_RNA) where: Base-Base interactions energy: -274.692 where: short stacking energy: -117.197 Base-Backbone interact. energy: -0.305 local terms energy: -133.070493 where: bonds (distance) C4'-P energy: -22.873 bonds (distance) P-C4' energy: -26.205 flat angles C4'-P-C4' energy: -30.660 flat angles P-C4'-P energy: -17.460 tors. eta vs tors. theta energy: -35.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 26 Temperature: 1.000000 Total energy: -373.650993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.650993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.650993 (E_RNA) where: Base-Base interactions energy: -256.096 where: short stacking energy: -102.541 Base-Backbone interact. energy: -0.465 local terms energy: -117.090171 where: bonds (distance) C4'-P energy: -22.167 bonds (distance) P-C4' energy: -32.785 flat angles C4'-P-C4' energy: -22.932 flat angles P-C4'-P energy: -17.481 tors. eta vs tors. theta energy: -21.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 26 Temperature: 1.050000 Total energy: -345.947382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.947382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.947382 (E_RNA) where: Base-Base interactions energy: -223.183 where: short stacking energy: -119.332 Base-Backbone interact. energy: -1.000 local terms energy: -121.764524 where: bonds (distance) C4'-P energy: -24.648 bonds (distance) P-C4' energy: -23.881 flat angles C4'-P-C4' energy: -26.204 flat angles P-C4'-P energy: -20.484 tors. eta vs tors. theta energy: -26.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 26 Temperature: 1.100000 Total energy: -315.540278 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.540278 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.540278 (E_RNA) where: Base-Base interactions energy: -204.867 where: short stacking energy: -89.178 Base-Backbone interact. energy: -0.086 local terms energy: -110.587549 where: bonds (distance) C4'-P energy: -25.143 bonds (distance) P-C4' energy: -21.016 flat angles C4'-P-C4' energy: -26.274 flat angles P-C4'-P energy: -16.639 tors. eta vs tors. theta energy: -21.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 26 Temperature: 1.150000 Total energy: -274.094438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.094438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.094438 (E_RNA) where: Base-Base interactions energy: -168.028 where: short stacking energy: -81.552 Base-Backbone interact. energy: -2.148 local terms energy: -103.918631 where: bonds (distance) C4'-P energy: -23.958 bonds (distance) P-C4' energy: -19.796 flat angles C4'-P-C4' energy: -25.914 flat angles P-C4'-P energy: -14.322 tors. eta vs tors. theta energy: -19.928 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 26 Temperature: 1.200000 Total energy: -275.163801 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.163801 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.163801 (E_RNA) where: Base-Base interactions energy: -172.590 where: short stacking energy: -88.967 Base-Backbone interact. energy: -0.100 local terms energy: -102.474117 where: bonds (distance) C4'-P energy: -19.178 bonds (distance) P-C4' energy: -26.686 flat angles C4'-P-C4' energy: -29.719 flat angles P-C4'-P energy: -9.821 tors. eta vs tors. theta energy: -17.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 26 Temperature: 1.250000 Total energy: -225.423578 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.423578 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.423578 (E_RNA) where: Base-Base interactions energy: -134.164 where: short stacking energy: -74.066 Base-Backbone interact. energy: 0.316 local terms energy: -91.575984 where: bonds (distance) C4'-P energy: -17.503 bonds (distance) P-C4' energy: -22.133 flat angles C4'-P-C4' energy: -21.417 flat angles P-C4'-P energy: -19.185 tors. eta vs tors. theta energy: -11.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 26 Temperature: 1.300000 Total energy: -251.343559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.343559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.343559 (E_RNA) where: Base-Base interactions energy: -153.146 where: short stacking energy: -82.379 Base-Backbone interact. energy: 0.568 local terms energy: -98.764870 where: bonds (distance) C4'-P energy: -23.776 bonds (distance) P-C4' energy: -23.026 flat angles C4'-P-C4' energy: -19.001 flat angles P-C4'-P energy: -16.302 tors. eta vs tors. theta energy: -16.659 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 26 Temperature: 1.350000 Total energy: -224.879525 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.879525 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.879525 (E_RNA) where: Base-Base interactions energy: -142.719 where: short stacking energy: -66.401 Base-Backbone interact. energy: -0.597 local terms energy: -81.563330 where: bonds (distance) C4'-P energy: -25.857 bonds (distance) P-C4' energy: -18.444 flat angles C4'-P-C4' energy: -17.601 flat angles P-C4'-P energy: -9.017 tors. eta vs tors. theta energy: -10.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 27 Temperature: 0.900000 Total energy: -472.114227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.114227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.114227 (E_RNA) where: Base-Base interactions energy: -326.053 where: short stacking energy: -151.446 Base-Backbone interact. energy: -1.720 local terms energy: -144.340296 where: bonds (distance) C4'-P energy: -26.173 bonds (distance) P-C4' energy: -25.331 flat angles C4'-P-C4' energy: -29.557 flat angles P-C4'-P energy: -17.403 tors. eta vs tors. theta energy: -45.876 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 27 Temperature: 0.950000 Total energy: -396.762825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.762825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.762825 (E_RNA) where: Base-Base interactions energy: -263.283 where: short stacking energy: -111.297 Base-Backbone interact. energy: 0.440 local terms energy: -133.919385 where: bonds (distance) C4'-P energy: -30.429 bonds (distance) P-C4' energy: -25.724 flat angles C4'-P-C4' energy: -28.203 flat angles P-C4'-P energy: -18.791 tors. eta vs tors. theta energy: -30.772 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 27 Temperature: 1.000000 Total energy: -375.642242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.642242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.642242 (E_RNA) where: Base-Base interactions energy: -250.588 where: short stacking energy: -109.511 Base-Backbone interact. energy: -0.356 local terms energy: -124.698056 where: bonds (distance) C4'-P energy: -26.351 bonds (distance) P-C4' energy: -21.074 flat angles C4'-P-C4' energy: -27.388 flat angles P-C4'-P energy: -25.074 tors. eta vs tors. theta energy: -24.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 27 Temperature: 1.050000 Total energy: -336.128717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -336.128717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -336.128717 (E_RNA) where: Base-Base interactions energy: -211.099 where: short stacking energy: -112.746 Base-Backbone interact. energy: -1.401 local terms energy: -123.628042 where: bonds (distance) C4'-P energy: -28.528 bonds (distance) P-C4' energy: -26.696 flat angles C4'-P-C4' energy: -22.171 flat angles P-C4'-P energy: -19.991 tors. eta vs tors. theta energy: -26.242 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 27 Temperature: 1.100000 Total energy: -341.832524 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -341.832524 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -341.832524 (E_RNA) where: Base-Base interactions energy: -231.689 where: short stacking energy: -107.008 Base-Backbone interact. energy: 0.599 local terms energy: -110.742777 where: bonds (distance) C4'-P energy: -26.731 bonds (distance) P-C4' energy: -18.648 flat angles C4'-P-C4' energy: -20.725 flat angles P-C4'-P energy: -17.353 tors. eta vs tors. theta energy: -27.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 27 Temperature: 1.150000 Total energy: -289.430926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.430926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.430926 (E_RNA) where: Base-Base interactions energy: -169.086 where: short stacking energy: -107.003 Base-Backbone interact. energy: -0.435 local terms energy: -119.909530 where: bonds (distance) C4'-P energy: -27.700 bonds (distance) P-C4' energy: -25.867 flat angles C4'-P-C4' energy: -18.772 flat angles P-C4'-P energy: -21.376 tors. eta vs tors. theta energy: -26.193 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 27 Temperature: 1.200000 Total energy: -279.866435 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.866435 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.866435 (E_RNA) where: Base-Base interactions energy: -181.244 where: short stacking energy: -89.174 Base-Backbone interact. energy: -0.291 local terms energy: -98.332212 where: bonds (distance) C4'-P energy: -17.713 bonds (distance) P-C4' energy: -23.126 flat angles C4'-P-C4' energy: -19.790 flat angles P-C4'-P energy: -14.383 tors. eta vs tors. theta energy: -23.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 27 Temperature: 1.250000 Total energy: -236.398551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.398551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.398551 (E_RNA) where: Base-Base interactions energy: -138.443 where: short stacking energy: -77.941 Base-Backbone interact. energy: -0.463 local terms energy: -97.492247 where: bonds (distance) C4'-P energy: -15.343 bonds (distance) P-C4' energy: -20.097 flat angles C4'-P-C4' energy: -24.682 flat angles P-C4'-P energy: -21.186 tors. eta vs tors. theta energy: -16.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 27 Temperature: 1.300000 Total energy: -248.678809 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.678809 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.678809 (E_RNA) where: Base-Base interactions energy: -140.725 where: short stacking energy: -82.104 Base-Backbone interact. energy: -1.201 local terms energy: -106.753090 where: bonds (distance) C4'-P energy: -23.225 bonds (distance) P-C4' energy: -28.763 flat angles C4'-P-C4' energy: -21.682 flat angles P-C4'-P energy: -15.205 tors. eta vs tors. theta energy: -17.878 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 27 Temperature: 1.350000 Total energy: -224.743145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.743145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.743145 (E_RNA) where: Base-Base interactions energy: -132.274 where: short stacking energy: -71.297 Base-Backbone interact. energy: 0.245 local terms energy: -92.713533 where: bonds (distance) C4'-P energy: -18.289 bonds (distance) P-C4' energy: -22.472 flat angles C4'-P-C4' energy: -27.225 flat angles P-C4'-P energy: -12.789 tors. eta vs tors. theta energy: -11.939 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 28 Temperature: 0.900000 Total energy: -462.794268 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.794268 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.794268 (E_RNA) where: Base-Base interactions energy: -313.976 where: short stacking energy: -147.103 Base-Backbone interact. energy: -0.670 local terms energy: -148.147893 where: bonds (distance) C4'-P energy: -24.355 bonds (distance) P-C4' energy: -27.864 flat angles C4'-P-C4' energy: -28.991 flat angles P-C4'-P energy: -22.859 tors. eta vs tors. theta energy: -44.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 28 Temperature: 0.950000 Total energy: -409.144654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.144654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.144654 (E_RNA) where: Base-Base interactions energy: -276.510 where: short stacking energy: -125.276 Base-Backbone interact. energy: -0.077 local terms energy: -132.558143 where: bonds (distance) C4'-P energy: -28.490 bonds (distance) P-C4' energy: -21.260 flat angles C4'-P-C4' energy: -27.250 flat angles P-C4'-P energy: -21.569 tors. eta vs tors. theta energy: -33.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 28 Temperature: 1.000000 Total energy: -390.272222 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.272222 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.272222 (E_RNA) where: Base-Base interactions energy: -256.197 where: short stacking energy: -126.860 Base-Backbone interact. energy: -1.049 local terms energy: -133.026749 where: bonds (distance) C4'-P energy: -26.040 bonds (distance) P-C4' energy: -23.038 flat angles C4'-P-C4' energy: -26.026 flat angles P-C4'-P energy: -20.719 tors. eta vs tors. theta energy: -37.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 28 Temperature: 1.050000 Total energy: -393.092318 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.092318 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.092318 (E_RNA) where: Base-Base interactions energy: -267.488 where: short stacking energy: -120.742 Base-Backbone interact. energy: -1.214 local terms energy: -124.390766 where: bonds (distance) C4'-P energy: -23.784 bonds (distance) P-C4' energy: -22.321 flat angles C4'-P-C4' energy: -28.198 flat angles P-C4'-P energy: -20.858 tors. eta vs tors. theta energy: -29.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 28 Temperature: 1.100000 Total energy: -339.228408 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.228408 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.228408 (E_RNA) where: Base-Base interactions energy: -215.163 where: short stacking energy: -99.703 Base-Backbone interact. energy: -1.755 local terms energy: -122.310442 where: bonds (distance) C4'-P energy: -26.255 bonds (distance) P-C4' energy: -24.676 flat angles C4'-P-C4' energy: -25.126 flat angles P-C4'-P energy: -19.112 tors. eta vs tors. theta energy: -27.142 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 28 Temperature: 1.150000 Total energy: -275.177987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.177987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.177987 (E_RNA) where: Base-Base interactions energy: -170.252 where: short stacking energy: -96.800 Base-Backbone interact. energy: -0.401 local terms energy: -104.525206 where: bonds (distance) C4'-P energy: -26.413 bonds (distance) P-C4' energy: -25.898 flat angles C4'-P-C4' energy: -21.906 flat angles P-C4'-P energy: -9.628 tors. eta vs tors. theta energy: -20.681 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 28 Temperature: 1.200000 Total energy: -262.039467 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.039467 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.039467 (E_RNA) where: Base-Base interactions energy: -158.901 where: short stacking energy: -88.887 Base-Backbone interact. energy: -0.655 local terms energy: -102.483609 where: bonds (distance) C4'-P energy: -26.070 bonds (distance) P-C4' energy: -22.887 flat angles C4'-P-C4' energy: -20.935 flat angles P-C4'-P energy: -14.233 tors. eta vs tors. theta energy: -18.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 28 Temperature: 1.250000 Total energy: -273.598960 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.598960 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.598960 (E_RNA) where: Base-Base interactions energy: -169.158 where: short stacking energy: -83.986 Base-Backbone interact. energy: 0.455 local terms energy: -104.896481 where: bonds (distance) C4'-P energy: -18.944 bonds (distance) P-C4' energy: -25.034 flat angles C4'-P-C4' energy: -23.247 flat angles P-C4'-P energy: -17.165 tors. eta vs tors. theta energy: -20.508 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 28 Temperature: 1.300000 Total energy: -230.078077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.078077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.078077 (E_RNA) where: Base-Base interactions energy: -135.975 where: short stacking energy: -73.172 Base-Backbone interact. energy: -0.150 local terms energy: -93.952945 where: bonds (distance) C4'-P energy: -20.619 bonds (distance) P-C4' energy: -25.477 flat angles C4'-P-C4' energy: -20.416 flat angles P-C4'-P energy: -16.212 tors. eta vs tors. theta energy: -11.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 28 Temperature: 1.350000 Total energy: -223.974269 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.974269 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.974269 (E_RNA) where: Base-Base interactions energy: -138.991 where: short stacking energy: -68.347 Base-Backbone interact. energy: -1.229 local terms energy: -83.753625 where: bonds (distance) C4'-P energy: -20.145 bonds (distance) P-C4' energy: -19.348 flat angles C4'-P-C4' energy: -21.709 flat angles P-C4'-P energy: -10.496 tors. eta vs tors. theta energy: -12.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 29 Temperature: 0.900000 Total energy: -476.205752 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -476.205752 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -476.205752 (E_RNA) where: Base-Base interactions energy: -331.962 where: short stacking energy: -139.443 Base-Backbone interact. energy: -2.070 local terms energy: -142.173844 where: bonds (distance) C4'-P energy: -29.373 bonds (distance) P-C4' energy: -24.865 flat angles C4'-P-C4' energy: -29.900 flat angles P-C4'-P energy: -18.666 tors. eta vs tors. theta energy: -39.370 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 29 Temperature: 0.950000 Total energy: -400.644987 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -400.644987 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -400.644987 (E_RNA) where: Base-Base interactions energy: -271.631 where: short stacking energy: -135.720 Base-Backbone interact. energy: -1.568 local terms energy: -127.445237 where: bonds (distance) C4'-P energy: -29.050 bonds (distance) P-C4' energy: -19.812 flat angles C4'-P-C4' energy: -24.551 flat angles P-C4'-P energy: -17.276 tors. eta vs tors. theta energy: -36.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 29 Temperature: 1.000000 Total energy: -399.921912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.921912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.921912 (E_RNA) where: Base-Base interactions energy: -270.601 where: short stacking energy: -125.096 Base-Backbone interact. energy: -1.224 local terms energy: -128.096539 where: bonds (distance) C4'-P energy: -27.886 bonds (distance) P-C4' energy: -23.199 flat angles C4'-P-C4' energy: -25.299 flat angles P-C4'-P energy: -18.829 tors. eta vs tors. theta energy: -32.884 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 29 Temperature: 1.050000 Total energy: -392.929182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.929182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.929182 (E_RNA) where: Base-Base interactions energy: -265.575 where: short stacking energy: -114.170 Base-Backbone interact. energy: -0.852 local terms energy: -126.501563 where: bonds (distance) C4'-P energy: -25.957 bonds (distance) P-C4' energy: -28.087 flat angles C4'-P-C4' energy: -22.997 flat angles P-C4'-P energy: -19.866 tors. eta vs tors. theta energy: -29.594 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 29 Temperature: 1.100000 Total energy: -344.966354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.966354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.966354 (E_RNA) where: Base-Base interactions energy: -227.318 where: short stacking energy: -104.181 Base-Backbone interact. energy: -0.985 local terms energy: -116.663039 where: bonds (distance) C4'-P energy: -27.609 bonds (distance) P-C4' energy: -24.295 flat angles C4'-P-C4' energy: -25.057 flat angles P-C4'-P energy: -14.708 tors. eta vs tors. theta energy: -24.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 29 Temperature: 1.150000 Total energy: -278.739151 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -278.739151 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -278.739151 (E_RNA) where: Base-Base interactions energy: -167.440 where: short stacking energy: -100.384 Base-Backbone interact. energy: 0.974 local terms energy: -112.273447 where: bonds (distance) C4'-P energy: -20.294 bonds (distance) P-C4' energy: -23.079 flat angles C4'-P-C4' energy: -28.579 flat angles P-C4'-P energy: -11.533 tors. eta vs tors. theta energy: -28.788 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 29 Temperature: 1.200000 Total energy: -255.514723 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.514723 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.514723 (E_RNA) where: Base-Base interactions energy: -144.261 where: short stacking energy: -77.526 Base-Backbone interact. energy: -0.815 local terms energy: -110.438100 where: bonds (distance) C4'-P energy: -24.082 bonds (distance) P-C4' energy: -29.697 flat angles C4'-P-C4' energy: -26.037 flat angles P-C4'-P energy: -14.835 tors. eta vs tors. theta energy: -15.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 29 Temperature: 1.250000 Total energy: -262.932128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.932128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.932128 (E_RNA) where: Base-Base interactions energy: -170.531 where: short stacking energy: -73.067 Base-Backbone interact. energy: -0.853 local terms energy: -91.547469 where: bonds (distance) C4'-P energy: -25.956 bonds (distance) P-C4' energy: -20.723 flat angles C4'-P-C4' energy: -19.444 flat angles P-C4'-P energy: -13.919 tors. eta vs tors. theta energy: -11.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 29 Temperature: 1.300000 Total energy: -245.571817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.571817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.571817 (E_RNA) where: Base-Base interactions energy: -151.886 where: short stacking energy: -75.513 Base-Backbone interact. energy: -0.284 local terms energy: -93.402264 where: bonds (distance) C4'-P energy: -24.032 bonds (distance) P-C4' energy: -22.858 flat angles C4'-P-C4' energy: -18.473 flat angles P-C4'-P energy: -17.551 tors. eta vs tors. theta energy: -10.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 29 Temperature: 1.350000 Total energy: -210.504484 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.504484 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.504484 (E_RNA) where: Base-Base interactions energy: -133.842 where: short stacking energy: -66.715 Base-Backbone interact. energy: -0.163 local terms energy: -76.499017 where: bonds (distance) C4'-P energy: -20.052 bonds (distance) P-C4' energy: -19.921 flat angles C4'-P-C4' energy: -28.497 flat angles P-C4'-P energy: 0.898 tors. eta vs tors. theta energy: -8.927 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 30 Temperature: 0.900000 Total energy: -469.541498 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.541498 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.541498 (E_RNA) where: Base-Base interactions energy: -322.655 where: short stacking energy: -143.167 Base-Backbone interact. energy: -0.992 local terms energy: -145.894374 where: bonds (distance) C4'-P energy: -29.733 bonds (distance) P-C4' energy: -21.076 flat angles C4'-P-C4' energy: -31.217 flat angles P-C4'-P energy: -20.640 tors. eta vs tors. theta energy: -43.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 30 Temperature: 0.950000 Total energy: -402.160041 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.160041 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.160041 (E_RNA) where: Base-Base interactions energy: -261.709 where: short stacking energy: -124.758 Base-Backbone interact. energy: -1.040 local terms energy: -139.410239 where: bonds (distance) C4'-P energy: -30.163 bonds (distance) P-C4' energy: -26.197 flat angles C4'-P-C4' energy: -29.643 flat angles P-C4'-P energy: -22.125 tors. eta vs tors. theta energy: -31.282 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 30 Temperature: 1.000000 Total energy: -399.051959 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.051959 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.051959 (E_RNA) where: Base-Base interactions energy: -263.506 where: short stacking energy: -106.945 Base-Backbone interact. energy: -1.931 local terms energy: -133.614307 where: bonds (distance) C4'-P energy: -27.743 bonds (distance) P-C4' energy: -30.210 flat angles C4'-P-C4' energy: -25.747 flat angles P-C4'-P energy: -20.222 tors. eta vs tors. theta energy: -29.693 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 30 Temperature: 1.050000 Total energy: -380.963899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.963899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.963899 (E_RNA) where: Base-Base interactions energy: -253.358 where: short stacking energy: -116.722 Base-Backbone interact. energy: 0.073 local terms energy: -127.678424 where: bonds (distance) C4'-P energy: -28.218 bonds (distance) P-C4' energy: -21.875 flat angles C4'-P-C4' energy: -29.400 flat angles P-C4'-P energy: -15.758 tors. eta vs tors. theta energy: -32.427 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 30 Temperature: 1.100000 Total energy: -331.748712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -331.748712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -331.748712 (E_RNA) where: Base-Base interactions energy: -223.124 where: short stacking energy: -94.990 Base-Backbone interact. energy: -1.294 local terms energy: -107.330618 where: bonds (distance) C4'-P energy: -24.074 bonds (distance) P-C4' energy: -25.053 flat angles C4'-P-C4' energy: -18.331 flat angles P-C4'-P energy: -15.384 tors. eta vs tors. theta energy: -24.489 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 30 Temperature: 1.150000 Total energy: -271.566187 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -271.566187 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -271.566187 (E_RNA) where: Base-Base interactions energy: -158.939 where: short stacking energy: -99.379 Base-Backbone interact. energy: -1.148 local terms energy: -111.479389 where: bonds (distance) C4'-P energy: -24.616 bonds (distance) P-C4' energy: -28.286 flat angles C4'-P-C4' energy: -25.148 flat angles P-C4'-P energy: -16.909 tors. eta vs tors. theta energy: -16.520 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 30 Temperature: 1.200000 Total energy: -294.730012 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.730012 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.730012 (E_RNA) where: Base-Base interactions energy: -202.610 where: short stacking energy: -107.539 Base-Backbone interact. energy: -0.091 local terms energy: -92.029005 where: bonds (distance) C4'-P energy: -20.513 bonds (distance) P-C4' energy: -17.741 flat angles C4'-P-C4' energy: -20.076 flat angles P-C4'-P energy: -9.831 tors. eta vs tors. theta energy: -23.868 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 30 Temperature: 1.250000 Total energy: -247.529725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.529725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.529725 (E_RNA) where: Base-Base interactions energy: -152.104 where: short stacking energy: -85.622 Base-Backbone interact. energy: 0.931 local terms energy: -96.356806 where: bonds (distance) C4'-P energy: -17.743 bonds (distance) P-C4' energy: -19.501 flat angles C4'-P-C4' energy: -26.616 flat angles P-C4'-P energy: -15.800 tors. eta vs tors. theta energy: -16.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 30 Temperature: 1.300000 Total energy: -235.881267 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.881267 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.881267 (E_RNA) where: Base-Base interactions energy: -138.284 where: short stacking energy: -66.432 Base-Backbone interact. energy: -0.124 local terms energy: -97.473121 where: bonds (distance) C4'-P energy: -20.550 bonds (distance) P-C4' energy: -24.980 flat angles C4'-P-C4' energy: -22.334 flat angles P-C4'-P energy: -16.209 tors. eta vs tors. theta energy: -13.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 30 Temperature: 1.350000 Total energy: -203.766464 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.766464 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.766464 (E_RNA) where: Base-Base interactions energy: -115.748 where: short stacking energy: -60.790 Base-Backbone interact. energy: -0.693 local terms energy: -87.325408 where: bonds (distance) C4'-P energy: -16.441 bonds (distance) P-C4' energy: -26.084 flat angles C4'-P-C4' energy: -25.304 flat angles P-C4'-P energy: -19.404 tors. eta vs tors. theta energy: -0.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 31 Temperature: 0.900000 Total energy: -464.318335 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.318335 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.318335 (E_RNA) where: Base-Base interactions energy: -309.251 where: short stacking energy: -142.458 Base-Backbone interact. energy: -2.650 local terms energy: -152.416648 where: bonds (distance) C4'-P energy: -30.549 bonds (distance) P-C4' energy: -26.658 flat angles C4'-P-C4' energy: -28.125 flat angles P-C4'-P energy: -22.703 tors. eta vs tors. theta energy: -44.381 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 31 Temperature: 0.950000 Total energy: -396.430487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.430487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.430487 (E_RNA) where: Base-Base interactions energy: -255.142 where: short stacking energy: -135.088 Base-Backbone interact. energy: -0.343 local terms energy: -140.945941 where: bonds (distance) C4'-P energy: -25.296 bonds (distance) P-C4' energy: -28.134 flat angles C4'-P-C4' energy: -30.679 flat angles P-C4'-P energy: -21.492 tors. eta vs tors. theta energy: -35.345 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 31 Temperature: 1.000000 Total energy: -397.639184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -397.639184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -397.639184 (E_RNA) where: Base-Base interactions energy: -269.435 where: short stacking energy: -112.303 Base-Backbone interact. energy: -0.003 local terms energy: -128.201014 where: bonds (distance) C4'-P energy: -29.667 bonds (distance) P-C4' energy: -26.291 flat angles C4'-P-C4' energy: -27.544 flat angles P-C4'-P energy: -18.508 tors. eta vs tors. theta energy: -26.192 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 31 Temperature: 1.050000 Total energy: -405.045206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.045206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.045206 (E_RNA) where: Base-Base interactions energy: -279.349 where: short stacking energy: -118.255 Base-Backbone interact. energy: -1.041 local terms energy: -124.654834 where: bonds (distance) C4'-P energy: -23.221 bonds (distance) P-C4' energy: -25.294 flat angles C4'-P-C4' energy: -30.491 flat angles P-C4'-P energy: -16.974 tors. eta vs tors. theta energy: -28.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 31 Temperature: 1.100000 Total energy: -330.794362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.794362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.794362 (E_RNA) where: Base-Base interactions energy: -221.042 where: short stacking energy: -97.114 Base-Backbone interact. energy: -1.021 local terms energy: -108.731604 where: bonds (distance) C4'-P energy: -22.791 bonds (distance) P-C4' energy: -20.217 flat angles C4'-P-C4' energy: -28.088 flat angles P-C4'-P energy: -17.663 tors. eta vs tors. theta energy: -19.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 31 Temperature: 1.150000 Total energy: -286.639177 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -286.639177 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -286.639177 (E_RNA) where: Base-Base interactions energy: -184.781 where: short stacking energy: -92.802 Base-Backbone interact. energy: -0.846 local terms energy: -101.012115 where: bonds (distance) C4'-P energy: -16.125 bonds (distance) P-C4' energy: -27.439 flat angles C4'-P-C4' energy: -22.814 flat angles P-C4'-P energy: -15.106 tors. eta vs tors. theta energy: -19.528 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 31 Temperature: 1.200000 Total energy: -255.145150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.145150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.145150 (E_RNA) where: Base-Base interactions energy: -155.103 where: short stacking energy: -80.781 Base-Backbone interact. energy: 0.059 local terms energy: -100.101011 where: bonds (distance) C4'-P energy: -22.003 bonds (distance) P-C4' energy: -20.293 flat angles C4'-P-C4' energy: -21.751 flat angles P-C4'-P energy: -19.608 tors. eta vs tors. theta energy: -16.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 31 Temperature: 1.250000 Total energy: -253.551882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.551882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.551882 (E_RNA) where: Base-Base interactions energy: -138.285 where: short stacking energy: -77.754 Base-Backbone interact. energy: -1.601 local terms energy: -113.665885 where: bonds (distance) C4'-P energy: -28.156 bonds (distance) P-C4' energy: -28.913 flat angles C4'-P-C4' energy: -22.470 flat angles P-C4'-P energy: -15.209 tors. eta vs tors. theta energy: -18.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 31 Temperature: 1.300000 Total energy: -246.312606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.312606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.312606 (E_RNA) where: Base-Base interactions energy: -154.366 where: short stacking energy: -79.386 Base-Backbone interact. energy: 0.107 local terms energy: -92.054065 where: bonds (distance) C4'-P energy: -28.089 bonds (distance) P-C4' energy: -21.207 flat angles C4'-P-C4' energy: -18.166 flat angles P-C4'-P energy: -11.602 tors. eta vs tors. theta energy: -12.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 31 Temperature: 1.350000 Total energy: -220.032636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.032636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.032636 (E_RNA) where: Base-Base interactions energy: -139.907 where: short stacking energy: -65.031 Base-Backbone interact. energy: -0.170 local terms energy: -79.955670 where: bonds (distance) C4'-P energy: -18.972 bonds (distance) P-C4' energy: -18.408 flat angles C4'-P-C4' energy: -20.437 flat angles P-C4'-P energy: -10.903 tors. eta vs tors. theta energy: -11.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 32 Temperature: 0.900000 Total energy: -451.464535 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.464535 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.464535 (E_RNA) where: Base-Base interactions energy: -308.230 where: short stacking energy: -144.104 Base-Backbone interact. energy: -0.906 local terms energy: -142.327919 where: bonds (distance) C4'-P energy: -25.960 bonds (distance) P-C4' energy: -26.317 flat angles C4'-P-C4' energy: -21.957 flat angles P-C4'-P energy: -21.776 tors. eta vs tors. theta energy: -46.318 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 32 Temperature: 0.950000 Total energy: -394.007715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.007715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.007715 (E_RNA) where: Base-Base interactions energy: -259.879 where: short stacking energy: -131.796 Base-Backbone interact. energy: -1.102 local terms energy: -133.026684 where: bonds (distance) C4'-P energy: -26.992 bonds (distance) P-C4' energy: -28.419 flat angles C4'-P-C4' energy: -27.171 flat angles P-C4'-P energy: -18.682 tors. eta vs tors. theta energy: -31.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 32 Temperature: 1.000000 Total energy: -399.861974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -399.861974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -399.861974 (E_RNA) where: Base-Base interactions energy: -273.121 where: short stacking energy: -114.677 Base-Backbone interact. energy: -2.204 local terms energy: -124.536938 where: bonds (distance) C4'-P energy: -25.366 bonds (distance) P-C4' energy: -26.825 flat angles C4'-P-C4' energy: -26.914 flat angles P-C4'-P energy: -19.193 tors. eta vs tors. theta energy: -26.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 32 Temperature: 1.050000 Total energy: -404.931981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.931981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.931981 (E_RNA) where: Base-Base interactions energy: -273.702 where: short stacking energy: -112.655 Base-Backbone interact. energy: -0.113 local terms energy: -131.117012 where: bonds (distance) C4'-P energy: -22.788 bonds (distance) P-C4' energy: -27.329 flat angles C4'-P-C4' energy: -33.263 flat angles P-C4'-P energy: -18.267 tors. eta vs tors. theta energy: -29.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 32 Temperature: 1.100000 Total energy: -358.820288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.820288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.820288 (E_RNA) where: Base-Base interactions energy: -247.951 where: short stacking energy: -95.747 Base-Backbone interact. energy: -0.496 local terms energy: -110.372928 where: bonds (distance) C4'-P energy: -21.963 bonds (distance) P-C4' energy: -22.093 flat angles C4'-P-C4' energy: -23.074 flat angles P-C4'-P energy: -17.215 tors. eta vs tors. theta energy: -26.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 32 Temperature: 1.150000 Total energy: -281.012326 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.012326 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.012326 (E_RNA) where: Base-Base interactions energy: -179.935 where: short stacking energy: -107.298 Base-Backbone interact. energy: -0.243 local terms energy: -100.833961 where: bonds (distance) C4'-P energy: -15.619 bonds (distance) P-C4' energy: -24.769 flat angles C4'-P-C4' energy: -22.055 flat angles P-C4'-P energy: -16.665 tors. eta vs tors. theta energy: -21.725 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 32 Temperature: 1.200000 Total energy: -260.905265 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.905265 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.905265 (E_RNA) where: Base-Base interactions energy: -155.187 where: short stacking energy: -99.437 Base-Backbone interact. energy: -2.316 local terms energy: -103.402419 where: bonds (distance) C4'-P energy: -22.972 bonds (distance) P-C4' energy: -20.254 flat angles C4'-P-C4' energy: -30.756 flat angles P-C4'-P energy: -12.241 tors. eta vs tors. theta energy: -17.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 32 Temperature: 1.250000 Total energy: -235.883364 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.883364 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.883364 (E_RNA) where: Base-Base interactions energy: -131.123 where: short stacking energy: -75.355 Base-Backbone interact. energy: 1.582 local terms energy: -106.342466 where: bonds (distance) C4'-P energy: -23.230 bonds (distance) P-C4' energy: -25.464 flat angles C4'-P-C4' energy: -25.099 flat angles P-C4'-P energy: -17.760 tors. eta vs tors. theta energy: -14.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 32 Temperature: 1.300000 Total energy: -254.467935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.467935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.467935 (E_RNA) where: Base-Base interactions energy: -148.707 where: short stacking energy: -82.241 Base-Backbone interact. energy: -1.167 local terms energy: -104.594267 where: bonds (distance) C4'-P energy: -17.569 bonds (distance) P-C4' energy: -28.550 flat angles C4'-P-C4' energy: -24.883 flat angles P-C4'-P energy: -15.778 tors. eta vs tors. theta energy: -17.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 32 Temperature: 1.350000 Total energy: -206.080768 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.080768 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.080768 (E_RNA) where: Base-Base interactions energy: -128.534 where: short stacking energy: -62.881 Base-Backbone interact. energy: 1.091 local terms energy: -78.636996 where: bonds (distance) C4'-P energy: -22.455 bonds (distance) P-C4' energy: -16.700 flat angles C4'-P-C4' energy: -15.323 flat angles P-C4'-P energy: -14.897 tors. eta vs tors. theta energy: -9.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 33 Temperature: 0.900000 Total energy: -472.012188 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.012188 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.012188 (E_RNA) where: Base-Base interactions energy: -320.868 where: short stacking energy: -145.959 Base-Backbone interact. energy: -0.021 local terms energy: -151.123174 where: bonds (distance) C4'-P energy: -26.599 bonds (distance) P-C4' energy: -30.833 flat angles C4'-P-C4' energy: -26.155 flat angles P-C4'-P energy: -22.487 tors. eta vs tors. theta energy: -45.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 33 Temperature: 0.950000 Total energy: -418.892431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -418.892431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -418.892431 (E_RNA) where: Base-Base interactions energy: -288.138 where: short stacking energy: -121.355 Base-Backbone interact. energy: -0.334 local terms energy: -130.419665 where: bonds (distance) C4'-P energy: -25.750 bonds (distance) P-C4' energy: -25.291 flat angles C4'-P-C4' energy: -28.512 flat angles P-C4'-P energy: -17.472 tors. eta vs tors. theta energy: -33.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 33 Temperature: 1.000000 Total energy: -407.502644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.502644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.502644 (E_RNA) where: Base-Base interactions energy: -291.382 where: short stacking energy: -119.082 Base-Backbone interact. energy: -1.372 local terms energy: -114.748651 where: bonds (distance) C4'-P energy: -24.754 bonds (distance) P-C4' energy: -26.289 flat angles C4'-P-C4' energy: -20.420 flat angles P-C4'-P energy: -13.455 tors. eta vs tors. theta energy: -29.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 33 Temperature: 1.050000 Total energy: -387.650687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.650687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.650687 (E_RNA) where: Base-Base interactions energy: -266.452 where: short stacking energy: -110.924 Base-Backbone interact. energy: 0.636 local terms energy: -121.834813 where: bonds (distance) C4'-P energy: -23.689 bonds (distance) P-C4' energy: -27.603 flat angles C4'-P-C4' energy: -26.591 flat angles P-C4'-P energy: -20.610 tors. eta vs tors. theta energy: -23.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 33 Temperature: 1.100000 Total energy: -411.057103 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.057103 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.057103 (E_RNA) where: Base-Base interactions energy: -284.149 where: short stacking energy: -129.075 Base-Backbone interact. energy: -1.364 local terms energy: -125.544459 where: bonds (distance) C4'-P energy: -26.239 bonds (distance) P-C4' energy: -21.047 flat angles C4'-P-C4' energy: -29.103 flat angles P-C4'-P energy: -18.278 tors. eta vs tors. theta energy: -30.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 33 Temperature: 1.150000 Total energy: -282.963218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.963218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.963218 (E_RNA) where: Base-Base interactions energy: -175.640 where: short stacking energy: -97.624 Base-Backbone interact. energy: 0.919 local terms energy: -108.242748 where: bonds (distance) C4'-P energy: -20.520 bonds (distance) P-C4' energy: -22.268 flat angles C4'-P-C4' energy: -26.609 flat angles P-C4'-P energy: -20.390 tors. eta vs tors. theta energy: -18.455 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 33 Temperature: 1.200000 Total energy: -253.901591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.901591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.901591 (E_RNA) where: Base-Base interactions energy: -162.937 where: short stacking energy: -76.941 Base-Backbone interact. energy: -0.155 local terms energy: -90.809615 where: bonds (distance) C4'-P energy: -22.190 bonds (distance) P-C4' energy: -22.781 flat angles C4'-P-C4' energy: -19.017 flat angles P-C4'-P energy: -14.747 tors. eta vs tors. theta energy: -12.075 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 33 Temperature: 1.250000 Total energy: -255.066912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.066912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.066912 (E_RNA) where: Base-Base interactions energy: -152.217 where: short stacking energy: -84.340 Base-Backbone interact. energy: -1.152 local terms energy: -101.697920 where: bonds (distance) C4'-P energy: -13.405 bonds (distance) P-C4' energy: -26.209 flat angles C4'-P-C4' energy: -28.049 flat angles P-C4'-P energy: -19.207 tors. eta vs tors. theta energy: -14.827 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 33 Temperature: 1.300000 Total energy: -227.636511 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.636511 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.636511 (E_RNA) where: Base-Base interactions energy: -127.032 where: short stacking energy: -59.997 Base-Backbone interact. energy: -0.226 local terms energy: -100.377975 where: bonds (distance) C4'-P energy: -25.579 bonds (distance) P-C4' energy: -26.180 flat angles C4'-P-C4' energy: -16.964 flat angles P-C4'-P energy: -16.886 tors. eta vs tors. theta energy: -14.770 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 33 Temperature: 1.350000 Total energy: -214.745209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.745209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.745209 (E_RNA) where: Base-Base interactions energy: -126.024 where: short stacking energy: -65.438 Base-Backbone interact. energy: -1.405 local terms energy: -87.316886 where: bonds (distance) C4'-P energy: -23.344 bonds (distance) P-C4' energy: -24.383 flat angles C4'-P-C4' energy: -18.290 flat angles P-C4'-P energy: -12.713 tors. eta vs tors. theta energy: -8.587 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 34 Temperature: 0.900000 Total energy: -461.953860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.953860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.953860 (E_RNA) where: Base-Base interactions energy: -318.304 where: short stacking energy: -152.248 Base-Backbone interact. energy: -0.052 local terms energy: -143.597643 where: bonds (distance) C4'-P energy: -28.072 bonds (distance) P-C4' energy: -27.304 flat angles C4'-P-C4' energy: -28.633 flat angles P-C4'-P energy: -19.343 tors. eta vs tors. theta energy: -40.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 34 Temperature: 0.950000 Total energy: -435.844146 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.844146 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.844146 (E_RNA) where: Base-Base interactions energy: -300.653 where: short stacking energy: -127.229 Base-Backbone interact. energy: -1.620 local terms energy: -133.570839 where: bonds (distance) C4'-P energy: -26.161 bonds (distance) P-C4' energy: -26.328 flat angles C4'-P-C4' energy: -24.407 flat angles P-C4'-P energy: -20.745 tors. eta vs tors. theta energy: -35.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 34 Temperature: 1.000000 Total energy: -417.778850 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.778850 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.778850 (E_RNA) where: Base-Base interactions energy: -292.188 where: short stacking energy: -106.777 Base-Backbone interact. energy: -1.266 local terms energy: -124.325050 where: bonds (distance) C4'-P energy: -25.217 bonds (distance) P-C4' energy: -21.359 flat angles C4'-P-C4' energy: -29.786 flat angles P-C4'-P energy: -21.762 tors. eta vs tors. theta energy: -26.202 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 34 Temperature: 1.050000 Total energy: -389.773988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.773988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.773988 (E_RNA) where: Base-Base interactions energy: -270.326 where: short stacking energy: -114.809 Base-Backbone interact. energy: -0.488 local terms energy: -118.959826 where: bonds (distance) C4'-P energy: -24.937 bonds (distance) P-C4' energy: -22.272 flat angles C4'-P-C4' energy: -27.788 flat angles P-C4'-P energy: -18.988 tors. eta vs tors. theta energy: -24.975 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 34 Temperature: 1.100000 Total energy: -395.940323 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.940323 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.940323 (E_RNA) where: Base-Base interactions energy: -268.021 where: short stacking energy: -111.977 Base-Backbone interact. energy: -0.325 local terms energy: -127.594589 where: bonds (distance) C4'-P energy: -27.629 bonds (distance) P-C4' energy: -23.777 flat angles C4'-P-C4' energy: -27.615 flat angles P-C4'-P energy: -16.752 tors. eta vs tors. theta energy: -31.821 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 34 Temperature: 1.150000 Total energy: -266.742510 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.742510 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.742510 (E_RNA) where: Base-Base interactions energy: -146.146 where: short stacking energy: -84.034 Base-Backbone interact. energy: -0.867 local terms energy: -119.730036 where: bonds (distance) C4'-P energy: -22.023 bonds (distance) P-C4' energy: -27.914 flat angles C4'-P-C4' energy: -31.817 flat angles P-C4'-P energy: -20.328 tors. eta vs tors. theta energy: -17.649 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 34 Temperature: 1.200000 Total energy: -261.651273 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.651273 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.651273 (E_RNA) where: Base-Base interactions energy: -154.205 where: short stacking energy: -74.467 Base-Backbone interact. energy: -0.587 local terms energy: -106.858947 where: bonds (distance) C4'-P energy: -22.603 bonds (distance) P-C4' energy: -26.427 flat angles C4'-P-C4' energy: -21.182 flat angles P-C4'-P energy: -17.873 tors. eta vs tors. theta energy: -18.774 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 34 Temperature: 1.250000 Total energy: -260.529111 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.529111 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.529111 (E_RNA) where: Base-Base interactions energy: -154.338 where: short stacking energy: -75.471 Base-Backbone interact. energy: -0.585 local terms energy: -105.606808 where: bonds (distance) C4'-P energy: -21.089 bonds (distance) P-C4' energy: -22.202 flat angles C4'-P-C4' energy: -29.508 flat angles P-C4'-P energy: -13.085 tors. eta vs tors. theta energy: -19.723 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 34 Temperature: 1.300000 Total energy: -228.606368 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.606368 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.606368 (E_RNA) where: Base-Base interactions energy: -130.520 where: short stacking energy: -66.694 Base-Backbone interact. energy: -0.188 local terms energy: -97.897992 where: bonds (distance) C4'-P energy: -19.888 bonds (distance) P-C4' energy: -25.282 flat angles C4'-P-C4' energy: -27.664 flat angles P-C4'-P energy: -8.516 tors. eta vs tors. theta energy: -16.548 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 34 Temperature: 1.350000 Total energy: -217.078736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.078736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.078736 (E_RNA) where: Base-Base interactions energy: -131.439 where: short stacking energy: -60.792 Base-Backbone interact. energy: -0.846 local terms energy: -84.793723 where: bonds (distance) C4'-P energy: -22.907 bonds (distance) P-C4' energy: -26.618 flat angles C4'-P-C4' energy: -17.949 flat angles P-C4'-P energy: -8.752 tors. eta vs tors. theta energy: -8.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 35 Temperature: 0.900000 Total energy: -460.485276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.485276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.485276 (E_RNA) where: Base-Base interactions energy: -319.749 where: short stacking energy: -148.421 Base-Backbone interact. energy: -0.040 local terms energy: -140.696220 where: bonds (distance) C4'-P energy: -25.000 bonds (distance) P-C4' energy: -28.053 flat angles C4'-P-C4' energy: -27.171 flat angles P-C4'-P energy: -19.855 tors. eta vs tors. theta energy: -40.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 35 Temperature: 0.950000 Total energy: -438.834832 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.834832 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.834832 (E_RNA) where: Base-Base interactions energy: -319.159 where: short stacking energy: -123.799 Base-Backbone interact. energy: -1.168 local terms energy: -118.507009 where: bonds (distance) C4'-P energy: -23.887 bonds (distance) P-C4' energy: -25.739 flat angles C4'-P-C4' energy: -25.518 flat angles P-C4'-P energy: -16.449 tors. eta vs tors. theta energy: -26.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 35 Temperature: 1.000000 Total energy: -437.632718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.632718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.632718 (E_RNA) where: Base-Base interactions energy: -309.533 where: short stacking energy: -137.845 Base-Backbone interact. energy: -0.733 local terms energy: -127.366535 where: bonds (distance) C4'-P energy: -23.845 bonds (distance) P-C4' energy: -20.532 flat angles C4'-P-C4' energy: -26.125 flat angles P-C4'-P energy: -16.172 tors. eta vs tors. theta energy: -40.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 35 Temperature: 1.050000 Total energy: -380.181156 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -380.181156 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -380.181156 (E_RNA) where: Base-Base interactions energy: -262.521 where: short stacking energy: -102.796 Base-Backbone interact. energy: -0.991 local terms energy: -116.668617 where: bonds (distance) C4'-P energy: -21.701 bonds (distance) P-C4' energy: -22.228 flat angles C4'-P-C4' energy: -29.781 flat angles P-C4'-P energy: -16.121 tors. eta vs tors. theta energy: -26.837 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 35 Temperature: 1.100000 Total energy: -411.376544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.376544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.376544 (E_RNA) where: Base-Base interactions energy: -270.669 where: short stacking energy: -125.026 Base-Backbone interact. energy: -1.388 local terms energy: -139.319849 where: bonds (distance) C4'-P energy: -26.633 bonds (distance) P-C4' energy: -27.923 flat angles C4'-P-C4' energy: -29.218 flat angles P-C4'-P energy: -20.638 tors. eta vs tors. theta energy: -34.909 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 35 Temperature: 1.150000 Total energy: -269.750788 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.750788 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.750788 (E_RNA) where: Base-Base interactions energy: -162.287 where: short stacking energy: -87.469 Base-Backbone interact. energy: -3.596 local terms energy: -103.866875 where: bonds (distance) C4'-P energy: -23.370 bonds (distance) P-C4' energy: -18.660 flat angles C4'-P-C4' energy: -28.037 flat angles P-C4'-P energy: -13.885 tors. eta vs tors. theta energy: -19.915 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 35 Temperature: 1.200000 Total energy: -233.041699 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.041699 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.041699 (E_RNA) where: Base-Base interactions energy: -139.463 where: short stacking energy: -75.248 Base-Backbone interact. energy: -0.518 local terms energy: -93.061243 where: bonds (distance) C4'-P energy: -28.603 bonds (distance) P-C4' energy: -19.947 flat angles C4'-P-C4' energy: -23.341 flat angles P-C4'-P energy: -13.498 tors. eta vs tors. theta energy: -7.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 9 ===================================== Write number: 35 Temperature: 1.250000 Total energy: -298.767860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.767860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.767860 (E_RNA) where: Base-Base interactions energy: -201.118 where: short stacking energy: -88.747 Base-Backbone interact. energy: -0.153 local terms energy: -97.496674 where: bonds (distance) C4'-P energy: -22.525 bonds (distance) P-C4' energy: -17.759 flat angles C4'-P-C4' energy: -23.157 flat angles P-C4'-P energy: -16.483 tors. eta vs tors. theta energy: -17.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 35 Temperature: 1.300000 Total energy: -229.217581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.217581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.217581 (E_RNA) where: Base-Base interactions energy: -139.052 where: short stacking energy: -88.251 Base-Backbone interact. energy: -0.621 local terms energy: -89.543791 where: bonds (distance) C4'-P energy: -19.817 bonds (distance) P-C4' energy: -24.279 flat angles C4'-P-C4' energy: -19.070 flat angles P-C4'-P energy: -13.092 tors. eta vs tors. theta energy: -13.286 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 35 Temperature: 1.350000 Total energy: -221.990509 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.990509 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.990509 (E_RNA) where: Base-Base interactions energy: -130.573 where: short stacking energy: -58.037 Base-Backbone interact. energy: -1.024 local terms energy: -90.393439 where: bonds (distance) C4'-P energy: -18.211 bonds (distance) P-C4' energy: -27.395 flat angles C4'-P-C4' energy: -19.943 flat angles P-C4'-P energy: -16.267 tors. eta vs tors. theta energy: -8.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 36 Temperature: 0.900000 Total energy: -468.124158 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.124158 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.124158 (E_RNA) where: Base-Base interactions energy: -313.707 where: short stacking energy: -142.489 Base-Backbone interact. energy: -0.000 local terms energy: -154.417331 where: bonds (distance) C4'-P energy: -27.076 bonds (distance) P-C4' energy: -26.521 flat angles C4'-P-C4' energy: -33.857 flat angles P-C4'-P energy: -21.531 tors. eta vs tors. theta energy: -45.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 6 ===================================== Write number: 36 Temperature: 0.950000 Total energy: -433.439477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.439477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.439477 (E_RNA) where: Base-Base interactions energy: -309.771 where: short stacking energy: -116.462 Base-Backbone interact. energy: -1.385 local terms energy: -122.282797 where: bonds (distance) C4'-P energy: -27.319 bonds (distance) P-C4' energy: -25.478 flat angles C4'-P-C4' energy: -25.416 flat angles P-C4'-P energy: -17.307 tors. eta vs tors. theta energy: -26.762 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 36 Temperature: 1.000000 Total energy: -411.094231 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.094231 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.094231 (E_RNA) where: Base-Base interactions energy: -287.472 where: short stacking energy: -113.949 Base-Backbone interact. energy: -0.176 local terms energy: -123.446465 where: bonds (distance) C4'-P energy: -23.367 bonds (distance) P-C4' energy: -23.224 flat angles C4'-P-C4' energy: -25.506 flat angles P-C4'-P energy: -19.143 tors. eta vs tors. theta energy: -32.206 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 36 Temperature: 1.050000 Total energy: -441.424621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.424621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.424621 (E_RNA) where: Base-Base interactions energy: -308.199 where: short stacking energy: -133.488 Base-Backbone interact. energy: -0.979 local terms energy: -132.247481 where: bonds (distance) C4'-P energy: -24.309 bonds (distance) P-C4' energy: -22.082 flat angles C4'-P-C4' energy: -25.053 flat angles P-C4'-P energy: -20.237 tors. eta vs tors. theta energy: -40.567 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 36 Temperature: 1.100000 Total energy: -405.007676 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -405.007676 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -405.007676 (E_RNA) where: Base-Base interactions energy: -277.287 where: short stacking energy: -121.992 Base-Backbone interact. energy: -1.043 local terms energy: -126.677134 where: bonds (distance) C4'-P energy: -21.378 bonds (distance) P-C4' energy: -31.103 flat angles C4'-P-C4' energy: -26.490 flat angles P-C4'-P energy: -15.634 tors. eta vs tors. theta energy: -32.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 10 ===================================== Write number: 36 Temperature: 1.150000 Total energy: -299.059392 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.059392 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.059392 (E_RNA) where: Base-Base interactions energy: -187.021 where: short stacking energy: -96.498 Base-Backbone interact. energy: -0.227 local terms energy: -111.810526 where: bonds (distance) C4'-P energy: -26.067 bonds (distance) P-C4' energy: -28.810 flat angles C4'-P-C4' energy: -24.337 flat angles P-C4'-P energy: -11.728 tors. eta vs tors. theta energy: -20.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 36 Temperature: 1.200000 Total energy: -374.092091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.092091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.092091 (E_RNA) where: Base-Base interactions energy: -249.763 where: short stacking energy: -117.551 Base-Backbone interact. energy: -1.172 local terms energy: -123.157111 where: bonds (distance) C4'-P energy: -23.697 bonds (distance) P-C4' energy: -19.949 flat angles C4'-P-C4' energy: -29.564 flat angles P-C4'-P energy: -20.453 tors. eta vs tors. theta energy: -29.495 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 36 Temperature: 1.250000 Total energy: -221.139540 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.139540 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.139540 (E_RNA) where: Base-Base interactions energy: -133.844 where: short stacking energy: -64.051 Base-Backbone interact. energy: -0.897 local terms energy: -86.398651 where: bonds (distance) C4'-P energy: -22.416 bonds (distance) P-C4' energy: -27.074 flat angles C4'-P-C4' energy: -20.486 flat angles P-C4'-P energy: -9.101 tors. eta vs tors. theta energy: -7.321 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 36 Temperature: 1.300000 Total energy: -242.931367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.931367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.931367 (E_RNA) where: Base-Base interactions energy: -137.324 where: short stacking energy: -84.946 Base-Backbone interact. energy: -0.192 local terms energy: -105.415176 where: bonds (distance) C4'-P energy: -23.069 bonds (distance) P-C4' energy: -26.452 flat angles C4'-P-C4' energy: -25.423 flat angles P-C4'-P energy: -13.039 tors. eta vs tors. theta energy: -17.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 36 Temperature: 1.350000 Total energy: -226.669624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.669624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.669624 (E_RNA) where: Base-Base interactions energy: -123.795 where: short stacking energy: -75.690 Base-Backbone interact. energy: 1.736 local terms energy: -104.610548 where: bonds (distance) C4'-P energy: -25.502 bonds (distance) P-C4' energy: -24.106 flat angles C4'-P-C4' energy: -25.391 flat angles P-C4'-P energy: -12.628 tors. eta vs tors. theta energy: -16.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 37 Temperature: 0.900000 Total energy: -463.087816 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.087816 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.087816 (E_RNA) where: Base-Base interactions energy: -321.736 where: short stacking energy: -155.581 Base-Backbone interact. energy: -0.005 local terms energy: -141.346628 where: bonds (distance) C4'-P energy: -27.285 bonds (distance) P-C4' energy: -23.900 flat angles C4'-P-C4' energy: -29.177 flat angles P-C4'-P energy: -21.112 tors. eta vs tors. theta energy: -39.872 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 37 Temperature: 0.950000 Total energy: -436.123803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.123803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.123803 (E_RNA) where: Base-Base interactions energy: -308.840 where: short stacking energy: -124.894 Base-Backbone interact. energy: -1.316 local terms energy: -125.967943 where: bonds (distance) C4'-P energy: -21.626 bonds (distance) P-C4' energy: -21.767 flat angles C4'-P-C4' energy: -27.443 flat angles P-C4'-P energy: -24.955 tors. eta vs tors. theta energy: -30.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 6 ===================================== Write number: 37 Temperature: 1.000000 Total energy: -430.532398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.532398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.532398 (E_RNA) where: Base-Base interactions energy: -298.337 where: short stacking energy: -111.974 Base-Backbone interact. energy: -0.921 local terms energy: -131.274395 where: bonds (distance) C4'-P energy: -25.323 bonds (distance) P-C4' energy: -27.977 flat angles C4'-P-C4' energy: -30.033 flat angles P-C4'-P energy: -19.176 tors. eta vs tors. theta energy: -28.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 37 Temperature: 1.050000 Total energy: -428.933817 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -428.933817 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -428.933817 (E_RNA) where: Base-Base interactions energy: -292.357 where: short stacking energy: -120.341 Base-Backbone interact. energy: -0.549 local terms energy: -136.027551 where: bonds (distance) C4'-P energy: -27.272 bonds (distance) P-C4' energy: -24.289 flat angles C4'-P-C4' energy: -32.388 flat angles P-C4'-P energy: -17.129 tors. eta vs tors. theta energy: -34.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 37 Temperature: 1.100000 Total energy: -416.540936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.540936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.540936 (E_RNA) where: Base-Base interactions energy: -282.746 where: short stacking energy: -134.405 Base-Backbone interact. energy: -1.236 local terms energy: -132.558762 where: bonds (distance) C4'-P energy: -25.883 bonds (distance) P-C4' energy: -17.576 flat angles C4'-P-C4' energy: -30.271 flat angles P-C4'-P energy: -20.133 tors. eta vs tors. theta energy: -38.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 37 Temperature: 1.150000 Total energy: -388.078644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.078644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.078644 (E_RNA) where: Base-Base interactions energy: -267.996 where: short stacking energy: -125.638 Base-Backbone interact. energy: -0.470 local terms energy: -119.612011 where: bonds (distance) C4'-P energy: -27.075 bonds (distance) P-C4' energy: -21.915 flat angles C4'-P-C4' energy: -22.683 flat angles P-C4'-P energy: -13.041 tors. eta vs tors. theta energy: -34.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 37 Temperature: 1.200000 Total energy: -282.939363 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.939363 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.939363 (E_RNA) where: Base-Base interactions energy: -174.239 where: short stacking energy: -95.858 Base-Backbone interact. energy: -0.044 local terms energy: -108.656209 where: bonds (distance) C4'-P energy: -27.143 bonds (distance) P-C4' energy: -24.996 flat angles C4'-P-C4' energy: -20.308 flat angles P-C4'-P energy: -12.916 tors. eta vs tors. theta energy: -23.294 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 37 Temperature: 1.250000 Total energy: -225.067309 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.067309 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.067309 (E_RNA) where: Base-Base interactions energy: -126.978 where: short stacking energy: -69.387 Base-Backbone interact. energy: -0.623 local terms energy: -97.466047 where: bonds (distance) C4'-P energy: -18.720 bonds (distance) P-C4' energy: -27.902 flat angles C4'-P-C4' energy: -21.678 flat angles P-C4'-P energy: -21.056 tors. eta vs tors. theta energy: -8.109 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 37 Temperature: 1.300000 Total energy: -236.256329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.256329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.256329 (E_RNA) where: Base-Base interactions energy: -147.180 where: short stacking energy: -82.141 Base-Backbone interact. energy: -1.500 local terms energy: -87.576976 where: bonds (distance) C4'-P energy: -17.260 bonds (distance) P-C4' energy: -19.722 flat angles C4'-P-C4' energy: -22.125 flat angles P-C4'-P energy: -15.972 tors. eta vs tors. theta energy: -12.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 37 Temperature: 1.350000 Total energy: -226.591709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.591709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.591709 (E_RNA) where: Base-Base interactions energy: -144.362 where: short stacking energy: -76.343 Base-Backbone interact. energy: -0.267 local terms energy: -81.962819 where: bonds (distance) C4'-P energy: -22.032 bonds (distance) P-C4' energy: -16.347 flat angles C4'-P-C4' energy: -19.435 flat angles P-C4'-P energy: -12.475 tors. eta vs tors. theta energy: -11.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 38 Temperature: 0.900000 Total energy: -471.166603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.166603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.166603 (E_RNA) where: Base-Base interactions energy: -322.040 where: short stacking energy: -154.427 Base-Backbone interact. energy: 0.141 local terms energy: -149.268016 where: bonds (distance) C4'-P energy: -24.632 bonds (distance) P-C4' energy: -27.610 flat angles C4'-P-C4' energy: -28.778 flat angles P-C4'-P energy: -23.867 tors. eta vs tors. theta energy: -44.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 38 Temperature: 0.950000 Total energy: -426.143760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.143760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.143760 (E_RNA) where: Base-Base interactions energy: -300.175 where: short stacking energy: -122.967 Base-Backbone interact. energy: -0.506 local terms energy: -125.462441 where: bonds (distance) C4'-P energy: -24.421 bonds (distance) P-C4' energy: -26.790 flat angles C4'-P-C4' energy: -25.256 flat angles P-C4'-P energy: -16.826 tors. eta vs tors. theta energy: -32.170 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 38 Temperature: 1.000000 Total energy: -446.155978 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.155978 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.155978 (E_RNA) where: Base-Base interactions energy: -297.454 where: short stacking energy: -134.489 Base-Backbone interact. energy: -0.542 local terms energy: -148.159855 where: bonds (distance) C4'-P energy: -24.099 bonds (distance) P-C4' energy: -26.532 flat angles C4'-P-C4' energy: -30.704 flat angles P-C4'-P energy: -24.155 tors. eta vs tors. theta energy: -42.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 38 Temperature: 1.050000 Total energy: -415.756672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.756672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.756672 (E_RNA) where: Base-Base interactions energy: -293.232 where: short stacking energy: -114.873 Base-Backbone interact. energy: -0.726 local terms energy: -121.799372 where: bonds (distance) C4'-P energy: -20.775 bonds (distance) P-C4' energy: -26.077 flat angles C4'-P-C4' energy: -29.858 flat angles P-C4'-P energy: -18.176 tors. eta vs tors. theta energy: -26.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 38 Temperature: 1.100000 Total energy: -379.540263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.540263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.540263 (E_RNA) where: Base-Base interactions energy: -265.866 where: short stacking energy: -117.023 Base-Backbone interact. energy: -0.404 local terms energy: -113.269794 where: bonds (distance) C4'-P energy: -22.238 bonds (distance) P-C4' energy: -15.197 flat angles C4'-P-C4' energy: -27.638 flat angles P-C4'-P energy: -18.795 tors. eta vs tors. theta energy: -29.401 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 38 Temperature: 1.150000 Total energy: -398.251700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -398.251700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -398.251700 (E_RNA) where: Base-Base interactions energy: -272.701 where: short stacking energy: -111.467 Base-Backbone interact. energy: -1.505 local terms energy: -124.045689 where: bonds (distance) C4'-P energy: -27.084 bonds (distance) P-C4' energy: -24.921 flat angles C4'-P-C4' energy: -21.223 flat angles P-C4'-P energy: -20.192 tors. eta vs tors. theta energy: -30.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 38 Temperature: 1.200000 Total energy: -258.936140 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.936140 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.936140 (E_RNA) where: Base-Base interactions energy: -146.169 where: short stacking energy: -75.401 Base-Backbone interact. energy: 2.998 local terms energy: -115.765071 where: bonds (distance) C4'-P energy: -23.664 bonds (distance) P-C4' energy: -22.475 flat angles C4'-P-C4' energy: -26.830 flat angles P-C4'-P energy: -20.851 tors. eta vs tors. theta energy: -21.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 38 Temperature: 1.250000 Total energy: -243.956994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.956994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.956994 (E_RNA) where: Base-Base interactions energy: -143.929 where: short stacking energy: -80.030 Base-Backbone interact. energy: -0.799 local terms energy: -99.228896 where: bonds (distance) C4'-P energy: -23.807 bonds (distance) P-C4' energy: -18.465 flat angles C4'-P-C4' energy: -25.546 flat angles P-C4'-P energy: -15.345 tors. eta vs tors. theta energy: -16.067 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 38 Temperature: 1.300000 Total energy: -209.751673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -209.751673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -209.751673 (E_RNA) where: Base-Base interactions energy: -127.457 where: short stacking energy: -59.627 Base-Backbone interact. energy: -0.679 local terms energy: -81.616265 where: bonds (distance) C4'-P energy: -18.940 bonds (distance) P-C4' energy: -19.066 flat angles C4'-P-C4' energy: -23.432 flat angles P-C4'-P energy: -11.871 tors. eta vs tors. theta energy: -8.308 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 38 Temperature: 1.350000 Total energy: -246.039302 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.039302 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.039302 (E_RNA) where: Base-Base interactions energy: -152.870 where: short stacking energy: -82.430 Base-Backbone interact. energy: -1.043 local terms energy: -92.126114 where: bonds (distance) C4'-P energy: -16.613 bonds (distance) P-C4' energy: -28.445 flat angles C4'-P-C4' energy: -17.702 flat angles P-C4'-P energy: -15.184 tors. eta vs tors. theta energy: -14.182 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 39 Temperature: 0.900000 Total energy: -456.176947 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.176947 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.176947 (E_RNA) where: Base-Base interactions energy: -302.401 where: short stacking energy: -138.844 Base-Backbone interact. energy: -0.284 local terms energy: -153.492394 where: bonds (distance) C4'-P energy: -26.657 bonds (distance) P-C4' energy: -25.873 flat angles C4'-P-C4' energy: -31.565 flat angles P-C4'-P energy: -27.025 tors. eta vs tors. theta energy: -42.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 39 Temperature: 0.950000 Total energy: -432.361330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.361330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.361330 (E_RNA) where: Base-Base interactions energy: -302.551 where: short stacking energy: -119.282 Base-Backbone interact. energy: -0.491 local terms energy: -129.319716 where: bonds (distance) C4'-P energy: -25.679 bonds (distance) P-C4' energy: -25.062 flat angles C4'-P-C4' energy: -24.378 flat angles P-C4'-P energy: -22.835 tors. eta vs tors. theta energy: -31.366 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 39 Temperature: 1.000000 Total energy: -441.511953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.511953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.511953 (E_RNA) where: Base-Base interactions energy: -306.965 where: short stacking energy: -136.722 Base-Backbone interact. energy: -0.332 local terms energy: -134.215217 where: bonds (distance) C4'-P energy: -21.222 bonds (distance) P-C4' energy: -21.933 flat angles C4'-P-C4' energy: -27.998 flat angles P-C4'-P energy: -19.369 tors. eta vs tors. theta energy: -43.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 39 Temperature: 1.050000 Total energy: -419.752624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.752624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.752624 (E_RNA) where: Base-Base interactions energy: -304.573 where: short stacking energy: -130.078 Base-Backbone interact. energy: -0.008 local terms energy: -115.172009 where: bonds (distance) C4'-P energy: -27.087 bonds (distance) P-C4' energy: -20.927 flat angles C4'-P-C4' energy: -18.988 flat angles P-C4'-P energy: -19.560 tors. eta vs tors. theta energy: -28.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 39 Temperature: 1.100000 Total energy: -388.775145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -388.775145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -388.775145 (E_RNA) where: Base-Base interactions energy: -253.268 where: short stacking energy: -118.168 Base-Backbone interact. energy: -1.170 local terms energy: -134.337382 where: bonds (distance) C4'-P energy: -27.588 bonds (distance) P-C4' energy: -28.421 flat angles C4'-P-C4' energy: -25.715 flat angles P-C4'-P energy: -22.638 tors. eta vs tors. theta energy: -29.974 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 39 Temperature: 1.150000 Total energy: -381.873620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.873620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.873620 (E_RNA) where: Base-Base interactions energy: -264.708 where: short stacking energy: -126.039 Base-Backbone interact. energy: -0.032 local terms energy: -117.133547 where: bonds (distance) C4'-P energy: -23.800 bonds (distance) P-C4' energy: -27.007 flat angles C4'-P-C4' energy: -16.992 flat angles P-C4'-P energy: -15.657 tors. eta vs tors. theta energy: -33.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 39 Temperature: 1.200000 Total energy: -239.332770 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.332770 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.332770 (E_RNA) where: Base-Base interactions energy: -138.062 where: short stacking energy: -65.527 Base-Backbone interact. energy: -0.355 local terms energy: -100.916260 where: bonds (distance) C4'-P energy: -27.599 bonds (distance) P-C4' energy: -27.098 flat angles C4'-P-C4' energy: -19.817 flat angles P-C4'-P energy: -13.724 tors. eta vs tors. theta energy: -12.677 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 39 Temperature: 1.250000 Total energy: -241.733620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.733620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.733620 (E_RNA) where: Base-Base interactions energy: -145.341 where: short stacking energy: -63.708 Base-Backbone interact. energy: 1.934 local terms energy: -98.326319 where: bonds (distance) C4'-P energy: -25.213 bonds (distance) P-C4' energy: -24.472 flat angles C4'-P-C4' energy: -16.187 flat angles P-C4'-P energy: -16.637 tors. eta vs tors. theta energy: -15.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 39 Temperature: 1.300000 Total energy: -214.534225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.534225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.534225 (E_RNA) where: Base-Base interactions energy: -123.803 where: short stacking energy: -63.146 Base-Backbone interact. energy: -0.409 local terms energy: -90.321828 where: bonds (distance) C4'-P energy: -19.819 bonds (distance) P-C4' energy: -23.991 flat angles C4'-P-C4' energy: -22.884 flat angles P-C4'-P energy: -14.473 tors. eta vs tors. theta energy: -9.155 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 39 Temperature: 1.350000 Total energy: -221.337150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.337150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.337150 (E_RNA) where: Base-Base interactions energy: -122.076 where: short stacking energy: -71.356 Base-Backbone interact. energy: -0.745 local terms energy: -98.515225 where: bonds (distance) C4'-P energy: -22.513 bonds (distance) P-C4' energy: -25.139 flat angles C4'-P-C4' energy: -26.267 flat angles P-C4'-P energy: -14.736 tors. eta vs tors. theta energy: -9.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 40 Temperature: 0.900000 Total energy: -470.923412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.923412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.923412 (E_RNA) where: Base-Base interactions energy: -323.015 where: short stacking energy: -150.568 Base-Backbone interact. energy: -1.555 local terms energy: -146.352493 where: bonds (distance) C4'-P energy: -26.130 bonds (distance) P-C4' energy: -21.969 flat angles C4'-P-C4' energy: -32.369 flat angles P-C4'-P energy: -22.605 tors. eta vs tors. theta energy: -43.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 40 Temperature: 0.950000 Total energy: -432.039060 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.039060 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.039060 (E_RNA) where: Base-Base interactions energy: -306.049 where: short stacking energy: -118.185 Base-Backbone interact. energy: -0.252 local terms energy: -125.737657 where: bonds (distance) C4'-P energy: -20.966 bonds (distance) P-C4' energy: -27.819 flat angles C4'-P-C4' energy: -29.313 flat angles P-C4'-P energy: -16.366 tors. eta vs tors. theta energy: -31.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 40 Temperature: 1.000000 Total energy: -447.438457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.438457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.438457 (E_RNA) where: Base-Base interactions energy: -297.824 where: short stacking energy: -139.273 Base-Backbone interact. energy: -0.400 local terms energy: -149.214475 where: bonds (distance) C4'-P energy: -26.802 bonds (distance) P-C4' energy: -30.050 flat angles C4'-P-C4' energy: -30.118 flat angles P-C4'-P energy: -19.573 tors. eta vs tors. theta energy: -42.672 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 40 Temperature: 1.050000 Total energy: -381.317185 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.317185 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.317185 (E_RNA) where: Base-Base interactions energy: -253.840 where: short stacking energy: -105.350 Base-Backbone interact. energy: -1.158 local terms energy: -126.318803 where: bonds (distance) C4'-P energy: -28.019 bonds (distance) P-C4' energy: -26.509 flat angles C4'-P-C4' energy: -28.304 flat angles P-C4'-P energy: -16.841 tors. eta vs tors. theta energy: -26.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 40 Temperature: 1.100000 Total energy: -386.765845 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.765845 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.765845 (E_RNA) where: Base-Base interactions energy: -262.744 where: short stacking energy: -113.617 Base-Backbone interact. energy: 0.105 local terms energy: -124.126710 where: bonds (distance) C4'-P energy: -26.393 bonds (distance) P-C4' energy: -23.732 flat angles C4'-P-C4' energy: -30.188 flat angles P-C4'-P energy: -15.698 tors. eta vs tors. theta energy: -28.116 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 40 Temperature: 1.150000 Total energy: -338.654263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -338.654263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -338.654263 (E_RNA) where: Base-Base interactions energy: -237.630 where: short stacking energy: -97.344 Base-Backbone interact. energy: 3.487 local terms energy: -104.511858 where: bonds (distance) C4'-P energy: -25.376 bonds (distance) P-C4' energy: -24.556 flat angles C4'-P-C4' energy: -19.174 flat angles P-C4'-P energy: -14.222 tors. eta vs tors. theta energy: -21.184 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 40 Temperature: 1.200000 Total energy: -249.981747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.981747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.981747 (E_RNA) where: Base-Base interactions energy: -151.388 where: short stacking energy: -72.197 Base-Backbone interact. energy: -0.587 local terms energy: -98.006788 where: bonds (distance) C4'-P energy: -25.603 bonds (distance) P-C4' energy: -21.655 flat angles C4'-P-C4' energy: -18.793 flat angles P-C4'-P energy: -17.176 tors. eta vs tors. theta energy: -14.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 40 Temperature: 1.250000 Total energy: -245.986734 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.986734 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.986734 (E_RNA) where: Base-Base interactions energy: -146.076 where: short stacking energy: -65.955 Base-Backbone interact. energy: -0.876 local terms energy: -99.034631 where: bonds (distance) C4'-P energy: -24.507 bonds (distance) P-C4' energy: -24.560 flat angles C4'-P-C4' energy: -24.551 flat angles P-C4'-P energy: -15.114 tors. eta vs tors. theta energy: -10.302 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 40 Temperature: 1.300000 Total energy: -228.578758 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.578758 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.578758 (E_RNA) where: Base-Base interactions energy: -131.396 where: short stacking energy: -69.351 Base-Backbone interact. energy: -1.215 local terms energy: -95.967682 where: bonds (distance) C4'-P energy: -17.771 bonds (distance) P-C4' energy: -25.383 flat angles C4'-P-C4' energy: -24.946 flat angles P-C4'-P energy: -9.356 tors. eta vs tors. theta energy: -18.512 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 40 Temperature: 1.350000 Total energy: -219.464477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.464477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.464477 (E_RNA) where: Base-Base interactions energy: -128.410 where: short stacking energy: -46.928 Base-Backbone interact. energy: -0.056 local terms energy: -90.998921 where: bonds (distance) C4'-P energy: -22.972 bonds (distance) P-C4' energy: -22.095 flat angles C4'-P-C4' energy: -18.067 flat angles P-C4'-P energy: -14.543 tors. eta vs tors. theta energy: -13.322 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 41 Temperature: 0.900000 Total energy: -458.138671 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.138671 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.138671 (E_RNA) where: Base-Base interactions energy: -308.009 where: short stacking energy: -138.583 Base-Backbone interact. energy: -1.615 local terms energy: -148.515292 where: bonds (distance) C4'-P energy: -25.332 bonds (distance) P-C4' energy: -27.433 flat angles C4'-P-C4' energy: -32.112 flat angles P-C4'-P energy: -21.297 tors. eta vs tors. theta energy: -42.342 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 41 Temperature: 0.950000 Total energy: -463.840136 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.840136 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.840136 (E_RNA) where: Base-Base interactions energy: -322.938 where: short stacking energy: -136.732 Base-Backbone interact. energy: -0.862 local terms energy: -140.040682 where: bonds (distance) C4'-P energy: -25.494 bonds (distance) P-C4' energy: -27.732 flat angles C4'-P-C4' energy: -29.855 flat angles P-C4'-P energy: -18.206 tors. eta vs tors. theta energy: -38.754 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 41 Temperature: 1.000000 Total energy: -429.606007 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.606007 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.606007 (E_RNA) where: Base-Base interactions energy: -296.559 where: short stacking energy: -119.841 Base-Backbone interact. energy: -0.619 local terms energy: -132.428186 where: bonds (distance) C4'-P energy: -25.899 bonds (distance) P-C4' energy: -28.514 flat angles C4'-P-C4' energy: -26.639 flat angles P-C4'-P energy: -21.587 tors. eta vs tors. theta energy: -29.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 41 Temperature: 1.050000 Total energy: -371.695937 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.695937 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.695937 (E_RNA) where: Base-Base interactions energy: -266.274 where: short stacking energy: -100.413 Base-Backbone interact. energy: -0.898 local terms energy: -104.523735 where: bonds (distance) C4'-P energy: -12.456 bonds (distance) P-C4' energy: -30.405 flat angles C4'-P-C4' energy: -21.492 flat angles P-C4'-P energy: -17.241 tors. eta vs tors. theta energy: -22.930 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 41 Temperature: 1.100000 Total energy: -390.648885 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.648885 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.648885 (E_RNA) where: Base-Base interactions energy: -267.355 where: short stacking energy: -129.362 Base-Backbone interact. energy: 1.002 local terms energy: -124.296367 where: bonds (distance) C4'-P energy: -25.160 bonds (distance) P-C4' energy: -22.791 flat angles C4'-P-C4' energy: -27.062 flat angles P-C4'-P energy: -20.630 tors. eta vs tors. theta energy: -28.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 41 Temperature: 1.150000 Total energy: -368.274602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.274602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.274602 (E_RNA) where: Base-Base interactions energy: -250.263 where: short stacking energy: -115.119 Base-Backbone interact. energy: 1.489 local terms energy: -119.500676 where: bonds (distance) C4'-P energy: -20.200 bonds (distance) P-C4' energy: -25.126 flat angles C4'-P-C4' energy: -29.448 flat angles P-C4'-P energy: -16.896 tors. eta vs tors. theta energy: -27.831 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 41 Temperature: 1.200000 Total energy: -246.040005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.040005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.040005 (E_RNA) where: Base-Base interactions energy: -141.493 where: short stacking energy: -80.714 Base-Backbone interact. energy: -0.183 local terms energy: -104.363547 where: bonds (distance) C4'-P energy: -24.433 bonds (distance) P-C4' energy: -27.639 flat angles C4'-P-C4' energy: -26.488 flat angles P-C4'-P energy: -15.054 tors. eta vs tors. theta energy: -10.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 41 Temperature: 1.250000 Total energy: -232.637581 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.637581 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.637581 (E_RNA) where: Base-Base interactions energy: -139.560 where: short stacking energy: -71.815 Base-Backbone interact. energy: 0.486 local terms energy: -93.563185 where: bonds (distance) C4'-P energy: -21.956 bonds (distance) P-C4' energy: -24.036 flat angles C4'-P-C4' energy: -21.674 flat angles P-C4'-P energy: -13.081 tors. eta vs tors. theta energy: -12.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 41 Temperature: 1.300000 Total energy: -237.465882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.465882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.465882 (E_RNA) where: Base-Base interactions energy: -142.967 where: short stacking energy: -78.583 Base-Backbone interact. energy: -0.007 local terms energy: -94.491573 where: bonds (distance) C4'-P energy: -23.261 bonds (distance) P-C4' energy: -20.111 flat angles C4'-P-C4' energy: -22.550 flat angles P-C4'-P energy: -14.270 tors. eta vs tors. theta energy: -14.299 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 4 ===================================== Write number: 41 Temperature: 1.350000 Total energy: -259.061704 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.061704 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.061704 (E_RNA) where: Base-Base interactions energy: -159.538 where: short stacking energy: -82.673 Base-Backbone interact. energy: -0.257 local terms energy: -99.265983 where: bonds (distance) C4'-P energy: -24.364 bonds (distance) P-C4' energy: -17.564 flat angles C4'-P-C4' energy: -24.614 flat angles P-C4'-P energy: -15.900 tors. eta vs tors. theta energy: -16.824 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 42 Temperature: 0.900000 Total energy: -469.509644 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.509644 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.509644 (E_RNA) where: Base-Base interactions energy: -323.087 where: short stacking energy: -155.966 Base-Backbone interact. energy: -0.243 local terms energy: -146.179297 where: bonds (distance) C4'-P energy: -17.660 bonds (distance) P-C4' energy: -28.611 flat angles C4'-P-C4' energy: -33.195 flat angles P-C4'-P energy: -21.186 tors. eta vs tors. theta energy: -45.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 42 Temperature: 0.950000 Total energy: -457.736494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.736494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.736494 (E_RNA) where: Base-Base interactions energy: -309.453 where: short stacking energy: -147.078 Base-Backbone interact. energy: -0.728 local terms energy: -147.555159 where: bonds (distance) C4'-P energy: -22.547 bonds (distance) P-C4' energy: -30.128 flat angles C4'-P-C4' energy: -30.331 flat angles P-C4'-P energy: -20.978 tors. eta vs tors. theta energy: -43.572 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 42 Temperature: 1.000000 Total energy: -444.116370 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.116370 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.116370 (E_RNA) where: Base-Base interactions energy: -316.484 where: short stacking energy: -130.527 Base-Backbone interact. energy: -1.252 local terms energy: -126.380622 where: bonds (distance) C4'-P energy: -21.711 bonds (distance) P-C4' energy: -24.215 flat angles C4'-P-C4' energy: -31.254 flat angles P-C4'-P energy: -16.171 tors. eta vs tors. theta energy: -33.028 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 6 ===================================== Write number: 42 Temperature: 1.050000 Total energy: -378.614837 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.614837 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.614837 (E_RNA) where: Base-Base interactions energy: -266.331 where: short stacking energy: -108.786 Base-Backbone interact. energy: 1.678 local terms energy: -113.961913 where: bonds (distance) C4'-P energy: -23.691 bonds (distance) P-C4' energy: -24.413 flat angles C4'-P-C4' energy: -24.412 flat angles P-C4'-P energy: -14.780 tors. eta vs tors. theta energy: -26.666 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 42 Temperature: 1.100000 Total energy: -374.986944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -374.986944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -374.986944 (E_RNA) where: Base-Base interactions energy: -252.640 where: short stacking energy: -109.883 Base-Backbone interact. energy: 1.046 local terms energy: -123.393072 where: bonds (distance) C4'-P energy: -21.326 bonds (distance) P-C4' energy: -28.323 flat angles C4'-P-C4' energy: -28.035 flat angles P-C4'-P energy: -18.089 tors. eta vs tors. theta energy: -27.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 42 Temperature: 1.150000 Total energy: -394.613754 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.613754 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.613754 (E_RNA) where: Base-Base interactions energy: -267.727 where: short stacking energy: -119.853 Base-Backbone interact. energy: -0.635 local terms energy: -126.251160 where: bonds (distance) C4'-P energy: -21.809 bonds (distance) P-C4' energy: -24.565 flat angles C4'-P-C4' energy: -28.787 flat angles P-C4'-P energy: -17.843 tors. eta vs tors. theta energy: -33.247 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 42 Temperature: 1.200000 Total energy: -262.211643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.211643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.211643 (E_RNA) where: Base-Base interactions energy: -165.260 where: short stacking energy: -87.382 Base-Backbone interact. energy: -0.862 local terms energy: -96.089685 where: bonds (distance) C4'-P energy: -16.091 bonds (distance) P-C4' energy: -29.150 flat angles C4'-P-C4' energy: -21.181 flat angles P-C4'-P energy: -11.491 tors. eta vs tors. theta energy: -18.176 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 42 Temperature: 1.250000 Total energy: -268.225775 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.225775 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.225775 (E_RNA) where: Base-Base interactions energy: -158.465 where: short stacking energy: -91.639 Base-Backbone interact. energy: -0.408 local terms energy: -109.352367 where: bonds (distance) C4'-P energy: -22.988 bonds (distance) P-C4' energy: -28.265 flat angles C4'-P-C4' energy: -20.745 flat angles P-C4'-P energy: -12.423 tors. eta vs tors. theta energy: -24.932 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 4 ===================================== Write number: 42 Temperature: 1.300000 Total energy: -288.679633 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.679633 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.679633 (E_RNA) where: Base-Base interactions energy: -164.711 where: short stacking energy: -80.326 Base-Backbone interact. energy: -1.783 local terms energy: -122.185891 where: bonds (distance) C4'-P energy: -22.924 bonds (distance) P-C4' energy: -25.517 flat angles C4'-P-C4' energy: -28.772 flat angles P-C4'-P energy: -21.976 tors. eta vs tors. theta energy: -22.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 42 Temperature: 1.350000 Total energy: -218.982085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -218.982085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -218.982085 (E_RNA) where: Base-Base interactions energy: -131.285 where: short stacking energy: -75.056 Base-Backbone interact. energy: 0.764 local terms energy: -88.460808 where: bonds (distance) C4'-P energy: -21.148 bonds (distance) P-C4' energy: -22.569 flat angles C4'-P-C4' energy: -15.248 flat angles P-C4'-P energy: -13.812 tors. eta vs tors. theta energy: -15.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 43 Temperature: 0.900000 Total energy: -471.645722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.645722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.645722 (E_RNA) where: Base-Base interactions energy: -318.559 where: short stacking energy: -144.605 Base-Backbone interact. energy: -0.001 local terms energy: -153.085288 where: bonds (distance) C4'-P energy: -26.160 bonds (distance) P-C4' energy: -31.470 flat angles C4'-P-C4' energy: -30.596 flat angles P-C4'-P energy: -18.212 tors. eta vs tors. theta energy: -46.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 43 Temperature: 0.950000 Total energy: -456.731501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.731501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.731501 (E_RNA) where: Base-Base interactions energy: -314.782 where: short stacking energy: -145.004 Base-Backbone interact. energy: 0.891 local terms energy: -142.840585 where: bonds (distance) C4'-P energy: -25.819 bonds (distance) P-C4' energy: -30.508 flat angles C4'-P-C4' energy: -27.258 flat angles P-C4'-P energy: -18.279 tors. eta vs tors. theta energy: -40.976 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 43 Temperature: 1.000000 Total energy: -434.106619 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.106619 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.106619 (E_RNA) where: Base-Base interactions energy: -306.988 where: short stacking energy: -119.834 Base-Backbone interact. energy: -0.368 local terms energy: -126.750646 where: bonds (distance) C4'-P energy: -22.898 bonds (distance) P-C4' energy: -25.921 flat angles C4'-P-C4' energy: -26.128 flat angles P-C4'-P energy: -17.618 tors. eta vs tors. theta energy: -34.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 43 Temperature: 1.050000 Total energy: -379.156600 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.156600 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.156600 (E_RNA) where: Base-Base interactions energy: -258.850 where: short stacking energy: -128.284 Base-Backbone interact. energy: -1.721 local terms energy: -118.585691 where: bonds (distance) C4'-P energy: -24.772 bonds (distance) P-C4' energy: -26.077 flat angles C4'-P-C4' energy: -23.203 flat angles P-C4'-P energy: -13.277 tors. eta vs tors. theta energy: -31.256 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 6 ===================================== Write number: 43 Temperature: 1.100000 Total energy: -360.640609 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -360.640609 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -360.640609 (E_RNA) where: Base-Base interactions energy: -242.523 where: short stacking energy: -112.154 Base-Backbone interact. energy: -0.237 local terms energy: -117.880767 where: bonds (distance) C4'-P energy: -22.960 bonds (distance) P-C4' energy: -24.690 flat angles C4'-P-C4' energy: -24.455 flat angles P-C4'-P energy: -17.192 tors. eta vs tors. theta energy: -28.583 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 43 Temperature: 1.150000 Total energy: -375.039645 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.039645 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.039645 (E_RNA) where: Base-Base interactions energy: -261.265 where: short stacking energy: -109.817 Base-Backbone interact. energy: 1.520 local terms energy: -115.294517 where: bonds (distance) C4'-P energy: -21.175 bonds (distance) P-C4' energy: -24.631 flat angles C4'-P-C4' energy: -19.284 flat angles P-C4'-P energy: -17.790 tors. eta vs tors. theta energy: -32.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 43 Temperature: 1.200000 Total energy: -257.386635 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.386635 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.386635 (E_RNA) where: Base-Base interactions energy: -166.517 where: short stacking energy: -92.582 Base-Backbone interact. energy: -0.041 local terms energy: -90.828227 where: bonds (distance) C4'-P energy: -22.770 bonds (distance) P-C4' energy: -19.202 flat angles C4'-P-C4' energy: -23.825 flat angles P-C4'-P energy: -14.224 tors. eta vs tors. theta energy: -10.808 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 4 ===================================== Write number: 43 Temperature: 1.250000 Total energy: -275.916841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -275.916841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -275.916841 (E_RNA) where: Base-Base interactions energy: -164.935 where: short stacking energy: -76.782 Base-Backbone interact. energy: -0.407 local terms energy: -110.574808 where: bonds (distance) C4'-P energy: -23.271 bonds (distance) P-C4' energy: -23.800 flat angles C4'-P-C4' energy: -21.394 flat angles P-C4'-P energy: -20.456 tors. eta vs tors. theta energy: -21.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 43 Temperature: 1.300000 Total energy: -259.580909 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.580909 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.580909 (E_RNA) where: Base-Base interactions energy: -169.948 where: short stacking energy: -80.079 Base-Backbone interact. energy: -0.453 local terms energy: -89.180428 where: bonds (distance) C4'-P energy: -17.554 bonds (distance) P-C4' energy: -26.289 flat angles C4'-P-C4' energy: -17.377 flat angles P-C4'-P energy: -8.509 tors. eta vs tors. theta energy: -19.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 43 Temperature: 1.350000 Total energy: -206.429422 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -206.429422 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -206.429422 (E_RNA) where: Base-Base interactions energy: -118.346 where: short stacking energy: -60.496 Base-Backbone interact. energy: -0.839 local terms energy: -87.243961 where: bonds (distance) C4'-P energy: -17.831 bonds (distance) P-C4' energy: -24.122 flat angles C4'-P-C4' energy: -23.273 flat angles P-C4'-P energy: -13.424 tors. eta vs tors. theta energy: -8.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 44 Temperature: 0.900000 Total energy: -458.423423 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.423423 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.423423 (E_RNA) where: Base-Base interactions energy: -316.150 where: short stacking energy: -140.905 Base-Backbone interact. energy: -0.964 local terms energy: -141.309581 where: bonds (distance) C4'-P energy: -28.666 bonds (distance) P-C4' energy: -23.965 flat angles C4'-P-C4' energy: -29.744 flat angles P-C4'-P energy: -17.363 tors. eta vs tors. theta energy: -41.571 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 44 Temperature: 0.950000 Total energy: -455.326731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.326731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.326731 (E_RNA) where: Base-Base interactions energy: -307.821 where: short stacking energy: -144.208 Base-Backbone interact. energy: -0.029 local terms energy: -147.477522 where: bonds (distance) C4'-P energy: -29.376 bonds (distance) P-C4' energy: -26.919 flat angles C4'-P-C4' energy: -31.313 flat angles P-C4'-P energy: -20.653 tors. eta vs tors. theta energy: -39.217 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 44 Temperature: 1.000000 Total energy: -423.193436 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.193436 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.193436 (E_RNA) where: Base-Base interactions energy: -298.363 where: short stacking energy: -121.587 Base-Backbone interact. energy: -0.820 local terms energy: -124.010525 where: bonds (distance) C4'-P energy: -25.917 bonds (distance) P-C4' energy: -23.454 flat angles C4'-P-C4' energy: -28.135 flat angles P-C4'-P energy: -17.567 tors. eta vs tors. theta energy: -28.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 44 Temperature: 1.050000 Total energy: -394.636236 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.636236 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.636236 (E_RNA) where: Base-Base interactions energy: -263.817 where: short stacking energy: -124.746 Base-Backbone interact. energy: -0.138 local terms energy: -130.681284 where: bonds (distance) C4'-P energy: -24.300 bonds (distance) P-C4' energy: -23.740 flat angles C4'-P-C4' energy: -27.397 flat angles P-C4'-P energy: -20.531 tors. eta vs tors. theta energy: -34.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 44 Temperature: 1.100000 Total energy: -390.693421 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.693421 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.693421 (E_RNA) where: Base-Base interactions energy: -260.423 where: short stacking energy: -126.958 Base-Backbone interact. energy: -0.036 local terms energy: -130.234119 where: bonds (distance) C4'-P energy: -23.812 bonds (distance) P-C4' energy: -27.057 flat angles C4'-P-C4' energy: -26.983 flat angles P-C4'-P energy: -18.098 tors. eta vs tors. theta energy: -34.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 44 Temperature: 1.150000 Total energy: -355.397092 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -355.397092 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -355.397092 (E_RNA) where: Base-Base interactions energy: -237.640 where: short stacking energy: -112.701 Base-Backbone interact. energy: 0.181 local terms energy: -117.937942 where: bonds (distance) C4'-P energy: -22.998 bonds (distance) P-C4' energy: -24.948 flat angles C4'-P-C4' energy: -23.223 flat angles P-C4'-P energy: -21.621 tors. eta vs tors. theta energy: -25.148 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 44 Temperature: 1.200000 Total energy: -289.296753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.296753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.296753 (E_RNA) where: Base-Base interactions energy: -175.498 where: short stacking energy: -82.220 Base-Backbone interact. energy: -1.041 local terms energy: -112.757401 where: bonds (distance) C4'-P energy: -25.659 bonds (distance) P-C4' energy: -24.985 flat angles C4'-P-C4' energy: -23.460 flat angles P-C4'-P energy: -21.717 tors. eta vs tors. theta energy: -16.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 44 Temperature: 1.250000 Total energy: -255.374160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.374160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.374160 (E_RNA) where: Base-Base interactions energy: -148.867 where: short stacking energy: -81.537 Base-Backbone interact. energy: -2.337 local terms energy: -104.170623 where: bonds (distance) C4'-P energy: -25.860 bonds (distance) P-C4' energy: -25.026 flat angles C4'-P-C4' energy: -21.308 flat angles P-C4'-P energy: -14.560 tors. eta vs tors. theta energy: -17.416 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 44 Temperature: 1.300000 Total energy: -232.979181 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.979181 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.979181 (E_RNA) where: Base-Base interactions energy: -127.522 where: short stacking energy: -66.549 Base-Backbone interact. energy: -0.964 local terms energy: -104.493532 where: bonds (distance) C4'-P energy: -21.292 bonds (distance) P-C4' energy: -28.629 flat angles C4'-P-C4' energy: -25.622 flat angles P-C4'-P energy: -16.702 tors. eta vs tors. theta energy: -12.249 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 44 Temperature: 1.350000 Total energy: -274.166420 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.166420 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.166420 (E_RNA) where: Base-Base interactions energy: -187.944 where: short stacking energy: -95.753 Base-Backbone interact. energy: 1.018 local terms energy: -87.240761 where: bonds (distance) C4'-P energy: -15.087 bonds (distance) P-C4' energy: -15.866 flat angles C4'-P-C4' energy: -23.461 flat angles P-C4'-P energy: -7.947 tors. eta vs tors. theta energy: -24.880 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 45 Temperature: 0.900000 Total energy: -455.861091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.861091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.861091 (E_RNA) where: Base-Base interactions energy: -314.649 where: short stacking energy: -138.004 Base-Backbone interact. energy: -0.288 local terms energy: -140.923987 where: bonds (distance) C4'-P energy: -22.517 bonds (distance) P-C4' energy: -32.576 flat angles C4'-P-C4' energy: -29.508 flat angles P-C4'-P energy: -19.381 tors. eta vs tors. theta energy: -36.943 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 45 Temperature: 0.950000 Total energy: -438.846032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.846032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.846032 (E_RNA) where: Base-Base interactions energy: -308.853 where: short stacking energy: -133.583 Base-Backbone interact. energy: -0.330 local terms energy: -129.662826 where: bonds (distance) C4'-P energy: -28.478 bonds (distance) P-C4' energy: -24.025 flat angles C4'-P-C4' energy: -22.380 flat angles P-C4'-P energy: -23.586 tors. eta vs tors. theta energy: -31.194 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 45 Temperature: 1.000000 Total energy: -448.349988 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.349988 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.349988 (E_RNA) where: Base-Base interactions energy: -307.544 where: short stacking energy: -137.842 Base-Backbone interact. energy: -0.219 local terms energy: -140.586688 where: bonds (distance) C4'-P energy: -24.429 bonds (distance) P-C4' energy: -24.216 flat angles C4'-P-C4' energy: -29.135 flat angles P-C4'-P energy: -17.301 tors. eta vs tors. theta energy: -45.505 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 45 Temperature: 1.050000 Total energy: -401.998598 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.998598 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.998598 (E_RNA) where: Base-Base interactions energy: -266.412 where: short stacking energy: -121.820 Base-Backbone interact. energy: -0.879 local terms energy: -134.707629 where: bonds (distance) C4'-P energy: -23.969 bonds (distance) P-C4' energy: -25.730 flat angles C4'-P-C4' energy: -32.238 flat angles P-C4'-P energy: -20.845 tors. eta vs tors. theta energy: -31.926 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 45 Temperature: 1.100000 Total energy: -391.579094 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -391.579094 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -391.579094 (E_RNA) where: Base-Base interactions energy: -271.300 where: short stacking energy: -127.016 Base-Backbone interact. energy: -1.102 local terms energy: -119.176818 where: bonds (distance) C4'-P energy: -25.735 bonds (distance) P-C4' energy: -22.160 flat angles C4'-P-C4' energy: -25.957 flat angles P-C4'-P energy: -15.080 tors. eta vs tors. theta energy: -30.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 45 Temperature: 1.150000 Total energy: -353.831401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -353.831401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -353.831401 (E_RNA) where: Base-Base interactions energy: -234.445 where: short stacking energy: -112.809 Base-Backbone interact. energy: -0.877 local terms energy: -118.509465 where: bonds (distance) C4'-P energy: -21.723 bonds (distance) P-C4' energy: -25.909 flat angles C4'-P-C4' energy: -28.259 flat angles P-C4'-P energy: -14.705 tors. eta vs tors. theta energy: -27.913 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 45 Temperature: 1.200000 Total energy: -295.718099 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.718099 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.718099 (E_RNA) where: Base-Base interactions energy: -190.781 where: short stacking energy: -101.572 Base-Backbone interact. energy: -1.602 local terms energy: -103.335547 where: bonds (distance) C4'-P energy: -17.808 bonds (distance) P-C4' energy: -16.343 flat angles C4'-P-C4' energy: -28.551 flat angles P-C4'-P energy: -12.131 tors. eta vs tors. theta energy: -28.502 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 45 Temperature: 1.250000 Total energy: -259.788255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -259.788255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -259.788255 (E_RNA) where: Base-Base interactions energy: -157.523 where: short stacking energy: -83.466 Base-Backbone interact. energy: -0.038 local terms energy: -102.226775 where: bonds (distance) C4'-P energy: -23.828 bonds (distance) P-C4' energy: -21.483 flat angles C4'-P-C4' energy: -22.725 flat angles P-C4'-P energy: -16.910 tors. eta vs tors. theta energy: -17.281 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 45 Temperature: 1.300000 Total energy: -230.957592 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.957592 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.957592 (E_RNA) where: Base-Base interactions energy: -131.391 where: short stacking energy: -66.402 Base-Backbone interact. energy: -1.084 local terms energy: -98.482575 where: bonds (distance) C4'-P energy: -20.706 bonds (distance) P-C4' energy: -23.018 flat angles C4'-P-C4' energy: -16.506 flat angles P-C4'-P energy: -18.953 tors. eta vs tors. theta energy: -19.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 45 Temperature: 1.350000 Total energy: -249.265312 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.265312 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.265312 (E_RNA) where: Base-Base interactions energy: -155.134 where: short stacking energy: -78.995 Base-Backbone interact. energy: -2.996 local terms energy: -91.135111 where: bonds (distance) C4'-P energy: -23.547 bonds (distance) P-C4' energy: -25.294 flat angles C4'-P-C4' energy: -17.939 flat angles P-C4'-P energy: -11.407 tors. eta vs tors. theta energy: -12.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 46 Temperature: 0.900000 Total energy: -470.456016 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.456016 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.456016 (E_RNA) where: Base-Base interactions energy: -318.008 where: short stacking energy: -146.198 Base-Backbone interact. energy: -2.000 local terms energy: -150.447974 where: bonds (distance) C4'-P energy: -30.768 bonds (distance) P-C4' energy: -22.901 flat angles C4'-P-C4' energy: -30.823 flat angles P-C4'-P energy: -23.303 tors. eta vs tors. theta energy: -42.653 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 46 Temperature: 0.950000 Total energy: -447.399673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.399673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.399673 (E_RNA) where: Base-Base interactions energy: -315.824 where: short stacking energy: -126.301 Base-Backbone interact. energy: -0.413 local terms energy: -131.162770 where: bonds (distance) C4'-P energy: -26.639 bonds (distance) P-C4' energy: -30.140 flat angles C4'-P-C4' energy: -23.803 flat angles P-C4'-P energy: -19.106 tors. eta vs tors. theta energy: -31.475 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 46 Temperature: 1.000000 Total energy: -445.531046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.531046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.531046 (E_RNA) where: Base-Base interactions energy: -311.843 where: short stacking energy: -141.395 Base-Backbone interact. energy: -0.016 local terms energy: -133.671675 where: bonds (distance) C4'-P energy: -24.350 bonds (distance) P-C4' energy: -27.244 flat angles C4'-P-C4' energy: -25.090 flat angles P-C4'-P energy: -18.584 tors. eta vs tors. theta energy: -38.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 46 Temperature: 1.050000 Total energy: -396.559672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.559672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.559672 (E_RNA) where: Base-Base interactions energy: -264.871 where: short stacking energy: -125.009 Base-Backbone interact. energy: -1.780 local terms energy: -129.907952 where: bonds (distance) C4'-P energy: -26.429 bonds (distance) P-C4' energy: -23.539 flat angles C4'-P-C4' energy: -25.090 flat angles P-C4'-P energy: -19.845 tors. eta vs tors. theta energy: -35.005 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 46 Temperature: 1.100000 Total energy: -381.963891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.963891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.963891 (E_RNA) where: Base-Base interactions energy: -270.763 where: short stacking energy: -115.724 Base-Backbone interact. energy: 0.066 local terms energy: -111.266116 where: bonds (distance) C4'-P energy: -21.151 bonds (distance) P-C4' energy: -19.981 flat angles C4'-P-C4' energy: -25.073 flat angles P-C4'-P energy: -15.013 tors. eta vs tors. theta energy: -30.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 46 Temperature: 1.150000 Total energy: -334.390591 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.390591 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.390591 (E_RNA) where: Base-Base interactions energy: -216.048 where: short stacking energy: -100.952 Base-Backbone interact. energy: -0.248 local terms energy: -118.094818 where: bonds (distance) C4'-P energy: -24.382 bonds (distance) P-C4' energy: -26.156 flat angles C4'-P-C4' energy: -23.634 flat angles P-C4'-P energy: -16.212 tors. eta vs tors. theta energy: -27.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 4 ===================================== Write number: 46 Temperature: 1.200000 Total energy: -318.301863 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -318.301863 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -318.301863 (E_RNA) where: Base-Base interactions energy: -217.154 where: short stacking energy: -98.199 Base-Backbone interact. energy: -0.982 local terms energy: -100.166039 where: bonds (distance) C4'-P energy: -16.158 bonds (distance) P-C4' energy: -26.736 flat angles C4'-P-C4' energy: -28.364 flat angles P-C4'-P energy: -7.703 tors. eta vs tors. theta energy: -21.205 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 46 Temperature: 1.250000 Total energy: -255.928193 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.928193 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.928193 (E_RNA) where: Base-Base interactions energy: -162.311 where: short stacking energy: -94.352 Base-Backbone interact. energy: -0.143 local terms energy: -93.473832 where: bonds (distance) C4'-P energy: -18.899 bonds (distance) P-C4' energy: -22.566 flat angles C4'-P-C4' energy: -19.654 flat angles P-C4'-P energy: -11.525 tors. eta vs tors. theta energy: -20.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 46 Temperature: 1.300000 Total energy: -225.822028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.822028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.822028 (E_RNA) where: Base-Base interactions energy: -134.764 where: short stacking energy: -77.278 Base-Backbone interact. energy: -0.371 local terms energy: -90.687083 where: bonds (distance) C4'-P energy: -20.316 bonds (distance) P-C4' energy: -26.705 flat angles C4'-P-C4' energy: -19.232 flat angles P-C4'-P energy: -14.839 tors. eta vs tors. theta energy: -9.596 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 46 Temperature: 1.350000 Total energy: -224.758879 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.758879 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.758879 (E_RNA) where: Base-Base interactions energy: -137.091 where: short stacking energy: -74.038 Base-Backbone interact. energy: 1.268 local terms energy: -88.935601 where: bonds (distance) C4'-P energy: -14.913 bonds (distance) P-C4' energy: -28.098 flat angles C4'-P-C4' energy: -24.706 flat angles P-C4'-P energy: -14.439 tors. eta vs tors. theta energy: -6.780 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 47 Temperature: 0.900000 Total energy: -471.293927 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.293927 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.293927 (E_RNA) where: Base-Base interactions energy: -322.785 where: short stacking energy: -155.872 Base-Backbone interact. energy: -0.034 local terms energy: -148.475004 where: bonds (distance) C4'-P energy: -29.651 bonds (distance) P-C4' energy: -24.036 flat angles C4'-P-C4' energy: -27.211 flat angles P-C4'-P energy: -22.063 tors. eta vs tors. theta energy: -45.515 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 47 Temperature: 0.950000 Total energy: -463.574747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.574747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.574747 (E_RNA) where: Base-Base interactions energy: -317.352 where: short stacking energy: -149.093 Base-Backbone interact. energy: -1.181 local terms energy: -145.041859 where: bonds (distance) C4'-P energy: -20.829 bonds (distance) P-C4' energy: -27.042 flat angles C4'-P-C4' energy: -32.392 flat angles P-C4'-P energy: -21.658 tors. eta vs tors. theta energy: -43.121 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 47 Temperature: 1.000000 Total energy: -433.937926 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.937926 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.937926 (E_RNA) where: Base-Base interactions energy: -308.157 where: short stacking energy: -121.263 Base-Backbone interact. energy: -1.328 local terms energy: -124.452880 where: bonds (distance) C4'-P energy: -26.876 bonds (distance) P-C4' energy: -24.347 flat angles C4'-P-C4' energy: -27.378 flat angles P-C4'-P energy: -17.306 tors. eta vs tors. theta energy: -28.545 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 47 Temperature: 1.050000 Total energy: -402.621500 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.621500 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.621500 (E_RNA) where: Base-Base interactions energy: -291.394 where: short stacking energy: -123.418 Base-Backbone interact. energy: -1.870 local terms energy: -109.357245 where: bonds (distance) C4'-P energy: -19.710 bonds (distance) P-C4' energy: -18.525 flat angles C4'-P-C4' energy: -24.195 flat angles P-C4'-P energy: -17.443 tors. eta vs tors. theta energy: -29.484 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 47 Temperature: 1.100000 Total energy: -375.489242 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.489242 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.489242 (E_RNA) where: Base-Base interactions energy: -249.803 where: short stacking energy: -123.675 Base-Backbone interact. energy: -2.276 local terms energy: -123.409958 where: bonds (distance) C4'-P energy: -22.164 bonds (distance) P-C4' energy: -24.831 flat angles C4'-P-C4' energy: -25.791 flat angles P-C4'-P energy: -18.705 tors. eta vs tors. theta energy: -31.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 47 Temperature: 1.150000 Total energy: -343.224120 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.224120 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.224120 (E_RNA) where: Base-Base interactions energy: -229.373 where: short stacking energy: -111.641 Base-Backbone interact. energy: -0.278 local terms energy: -113.573311 where: bonds (distance) C4'-P energy: -18.998 bonds (distance) P-C4' energy: -22.646 flat angles C4'-P-C4' energy: -27.212 flat angles P-C4'-P energy: -17.490 tors. eta vs tors. theta energy: -27.228 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 47 Temperature: 1.200000 Total energy: -339.300311 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.300311 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.300311 (E_RNA) where: Base-Base interactions energy: -232.568 where: short stacking energy: -97.817 Base-Backbone interact. energy: -1.268 local terms energy: -105.464549 where: bonds (distance) C4'-P energy: -21.982 bonds (distance) P-C4' energy: -26.900 flat angles C4'-P-C4' energy: -19.320 flat angles P-C4'-P energy: -11.986 tors. eta vs tors. theta energy: -25.277 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 47 Temperature: 1.250000 Total energy: -257.658046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.658046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.658046 (E_RNA) where: Base-Base interactions energy: -151.414 where: short stacking energy: -78.388 Base-Backbone interact. energy: 0.339 local terms energy: -106.583441 where: bonds (distance) C4'-P energy: -23.105 bonds (distance) P-C4' energy: -26.483 flat angles C4'-P-C4' energy: -20.994 flat angles P-C4'-P energy: -16.188 tors. eta vs tors. theta energy: -19.814 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 47 Temperature: 1.300000 Total energy: -232.171118 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.171118 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.171118 (E_RNA) where: Base-Base interactions energy: -137.616 where: short stacking energy: -54.472 Base-Backbone interact. energy: -0.565 local terms energy: -93.989983 where: bonds (distance) C4'-P energy: -18.262 bonds (distance) P-C4' energy: -26.861 flat angles C4'-P-C4' energy: -21.964 flat angles P-C4'-P energy: -14.931 tors. eta vs tors. theta energy: -11.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 47 Temperature: 1.350000 Total energy: -219.890038 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.890038 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.890038 (E_RNA) where: Base-Base interactions energy: -115.650 where: short stacking energy: -75.428 Base-Backbone interact. energy: -0.055 local terms energy: -104.185880 where: bonds (distance) C4'-P energy: -19.124 bonds (distance) P-C4' energy: -27.057 flat angles C4'-P-C4' energy: -23.913 flat angles P-C4'-P energy: -14.195 tors. eta vs tors. theta energy: -19.897 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 48 Temperature: 0.900000 Total energy: -464.091979 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.091979 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.091979 (E_RNA) where: Base-Base interactions energy: -316.084 where: short stacking energy: -148.276 Base-Backbone interact. energy: -0.370 local terms energy: -147.637332 where: bonds (distance) C4'-P energy: -30.054 bonds (distance) P-C4' energy: -26.010 flat angles C4'-P-C4' energy: -28.522 flat angles P-C4'-P energy: -20.070 tors. eta vs tors. theta energy: -42.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 48 Temperature: 0.950000 Total energy: -456.886640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.886640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.886640 (E_RNA) where: Base-Base interactions energy: -317.203 where: short stacking energy: -142.676 Base-Backbone interact. energy: -1.242 local terms energy: -138.441507 where: bonds (distance) C4'-P energy: -25.153 bonds (distance) P-C4' energy: -24.862 flat angles C4'-P-C4' energy: -25.177 flat angles P-C4'-P energy: -20.541 tors. eta vs tors. theta energy: -42.709 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 48 Temperature: 1.000000 Total energy: -437.722877 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.722877 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.722877 (E_RNA) where: Base-Base interactions energy: -311.645 where: short stacking energy: -121.060 Base-Backbone interact. energy: -1.446 local terms energy: -124.631214 where: bonds (distance) C4'-P energy: -22.841 bonds (distance) P-C4' energy: -29.322 flat angles C4'-P-C4' energy: -24.879 flat angles P-C4'-P energy: -22.289 tors. eta vs tors. theta energy: -25.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 48 Temperature: 1.050000 Total energy: -394.006080 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.006080 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.006080 (E_RNA) where: Base-Base interactions energy: -263.529 where: short stacking energy: -118.002 Base-Backbone interact. energy: -0.180 local terms energy: -130.297018 where: bonds (distance) C4'-P energy: -25.129 bonds (distance) P-C4' energy: -27.695 flat angles C4'-P-C4' energy: -27.238 flat angles P-C4'-P energy: -17.049 tors. eta vs tors. theta energy: -33.186 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 48 Temperature: 1.100000 Total energy: -342.390372 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.390372 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.390372 (E_RNA) where: Base-Base interactions energy: -234.834 where: short stacking energy: -111.423 Base-Backbone interact. energy: -0.202 local terms energy: -107.354466 where: bonds (distance) C4'-P energy: -13.379 bonds (distance) P-C4' energy: -19.326 flat angles C4'-P-C4' energy: -26.855 flat angles P-C4'-P energy: -20.248 tors. eta vs tors. theta energy: -27.547 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 48 Temperature: 1.150000 Total energy: -350.350254 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -350.350254 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -350.350254 (E_RNA) where: Base-Base interactions energy: -240.036 where: short stacking energy: -107.251 Base-Backbone interact. energy: -0.142 local terms energy: -110.172840 where: bonds (distance) C4'-P energy: -24.406 bonds (distance) P-C4' energy: -22.925 flat angles C4'-P-C4' energy: -23.510 flat angles P-C4'-P energy: -13.825 tors. eta vs tors. theta energy: -25.507 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 48 Temperature: 1.200000 Total energy: -343.637797 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.637797 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.637797 (E_RNA) where: Base-Base interactions energy: -225.078 where: short stacking energy: -103.227 Base-Backbone interact. energy: -0.142 local terms energy: -118.418469 where: bonds (distance) C4'-P energy: -22.379 bonds (distance) P-C4' energy: -22.338 flat angles C4'-P-C4' energy: -23.841 flat angles P-C4'-P energy: -22.020 tors. eta vs tors. theta energy: -27.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 48 Temperature: 1.250000 Total energy: -242.237293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.237293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.237293 (E_RNA) where: Base-Base interactions energy: -149.809 where: short stacking energy: -89.778 Base-Backbone interact. energy: -0.457 local terms energy: -91.971676 where: bonds (distance) C4'-P energy: -20.824 bonds (distance) P-C4' energy: -26.854 flat angles C4'-P-C4' energy: -22.611 flat angles P-C4'-P energy: -7.550 tors. eta vs tors. theta energy: -14.132 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 48 Temperature: 1.300000 Total energy: -235.387456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.387456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.387456 (E_RNA) where: Base-Base interactions energy: -144.307 where: short stacking energy: -69.145 Base-Backbone interact. energy: -0.892 local terms energy: -90.188096 where: bonds (distance) C4'-P energy: -18.123 bonds (distance) P-C4' energy: -19.379 flat angles C4'-P-C4' energy: -28.544 flat angles P-C4'-P energy: -14.889 tors. eta vs tors. theta energy: -9.254 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 48 Temperature: 1.350000 Total energy: -220.853772 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.853772 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.853772 (E_RNA) where: Base-Base interactions energy: -140.212 where: short stacking energy: -66.518 Base-Backbone interact. energy: -0.170 local terms energy: -80.471265 where: bonds (distance) C4'-P energy: -19.150 bonds (distance) P-C4' energy: -26.184 flat angles C4'-P-C4' energy: -13.585 flat angles P-C4'-P energy: -11.248 tors. eta vs tors. theta energy: -10.305 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 49 Temperature: 0.900000 Total energy: -457.940209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.940209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.940209 (E_RNA) where: Base-Base interactions energy: -309.471 where: short stacking energy: -133.143 Base-Backbone interact. energy: -1.818 local terms energy: -146.651601 where: bonds (distance) C4'-P energy: -26.445 bonds (distance) P-C4' energy: -29.100 flat angles C4'-P-C4' energy: -29.910 flat angles P-C4'-P energy: -18.961 tors. eta vs tors. theta energy: -42.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 49 Temperature: 0.950000 Total energy: -435.705085 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.705085 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.705085 (E_RNA) where: Base-Base interactions energy: -310.405 where: short stacking energy: -118.968 Base-Backbone interact. energy: -0.393 local terms energy: -124.907159 where: bonds (distance) C4'-P energy: -22.619 bonds (distance) P-C4' energy: -28.123 flat angles C4'-P-C4' energy: -28.435 flat angles P-C4'-P energy: -16.869 tors. eta vs tors. theta energy: -28.861 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 49 Temperature: 1.000000 Total energy: -445.900442 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.900442 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.900442 (E_RNA) where: Base-Base interactions energy: -315.398 where: short stacking energy: -139.246 Base-Backbone interact. energy: -0.595 local terms energy: -129.908346 where: bonds (distance) C4'-P energy: -16.636 bonds (distance) P-C4' energy: -21.124 flat angles C4'-P-C4' energy: -29.914 flat angles P-C4'-P energy: -21.313 tors. eta vs tors. theta energy: -40.922 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 49 Temperature: 1.050000 Total energy: -394.921091 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.921091 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.921091 (E_RNA) where: Base-Base interactions energy: -276.368 where: short stacking energy: -121.407 Base-Backbone interact. energy: -0.988 local terms energy: -117.564921 where: bonds (distance) C4'-P energy: -18.613 bonds (distance) P-C4' energy: -19.795 flat angles C4'-P-C4' energy: -27.835 flat angles P-C4'-P energy: -18.974 tors. eta vs tors. theta energy: -32.349 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 49 Temperature: 1.100000 Total energy: -352.810175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.810175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.810175 (E_RNA) where: Base-Base interactions energy: -229.763 where: short stacking energy: -108.680 Base-Backbone interact. energy: -0.245 local terms energy: -122.801941 where: bonds (distance) C4'-P energy: -25.639 bonds (distance) P-C4' energy: -27.522 flat angles C4'-P-C4' energy: -29.274 flat angles P-C4'-P energy: -10.007 tors. eta vs tors. theta energy: -30.360 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 49 Temperature: 1.150000 Total energy: -330.102869 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -330.102869 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -330.102869 (E_RNA) where: Base-Base interactions energy: -213.001 where: short stacking energy: -102.893 Base-Backbone interact. energy: -1.191 local terms energy: -115.910636 where: bonds (distance) C4'-P energy: -17.159 bonds (distance) P-C4' energy: -28.266 flat angles C4'-P-C4' energy: -28.350 flat angles P-C4'-P energy: -19.926 tors. eta vs tors. theta energy: -22.209 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 49 Temperature: 1.200000 Total energy: -366.118663 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.118663 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.118663 (E_RNA) where: Base-Base interactions energy: -250.086 where: short stacking energy: -122.824 Base-Backbone interact. energy: -1.197 local terms energy: -114.835651 where: bonds (distance) C4'-P energy: -22.194 bonds (distance) P-C4' energy: -22.117 flat angles C4'-P-C4' energy: -22.204 flat angles P-C4'-P energy: -16.933 tors. eta vs tors. theta energy: -31.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 49 Temperature: 1.250000 Total energy: -239.255899 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.255899 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.255899 (E_RNA) where: Base-Base interactions energy: -149.161 where: short stacking energy: -69.662 Base-Backbone interact. energy: -0.793 local terms energy: -89.302095 where: bonds (distance) C4'-P energy: -23.178 bonds (distance) P-C4' energy: -27.435 flat angles C4'-P-C4' energy: -18.820 flat angles P-C4'-P energy: -10.827 tors. eta vs tors. theta energy: -9.042 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 49 Temperature: 1.300000 Total energy: -212.357618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.357618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.357618 (E_RNA) where: Base-Base interactions energy: -121.838 where: short stacking energy: -68.444 Base-Backbone interact. energy: -0.223 local terms energy: -90.296248 where: bonds (distance) C4'-P energy: -25.816 bonds (distance) P-C4' energy: -16.133 flat angles C4'-P-C4' energy: -25.440 flat angles P-C4'-P energy: -15.717 tors. eta vs tors. theta energy: -7.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 8 ===================================== Write number: 49 Temperature: 1.350000 Total energy: -210.349996 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.349996 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.349996 (E_RNA) where: Base-Base interactions energy: -128.826 where: short stacking energy: -70.050 Base-Backbone interact. energy: 0.133 local terms energy: -81.656902 where: bonds (distance) C4'-P energy: -22.661 bonds (distance) P-C4' energy: -21.935 flat angles C4'-P-C4' energy: -20.075 flat angles P-C4'-P energy: -8.751 tors. eta vs tors. theta energy: -8.235 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 50 Temperature: 0.900000 Total energy: -456.652595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.652595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.652595 (E_RNA) where: Base-Base interactions energy: -310.137 where: short stacking energy: -134.021 Base-Backbone interact. energy: -0.327 local terms energy: -146.189163 where: bonds (distance) C4'-P energy: -24.695 bonds (distance) P-C4' energy: -28.770 flat angles C4'-P-C4' energy: -28.396 flat angles P-C4'-P energy: -24.363 tors. eta vs tors. theta energy: -39.965 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 50 Temperature: 0.950000 Total energy: -434.874688 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.874688 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.874688 (E_RNA) where: Base-Base interactions energy: -308.185 where: short stacking energy: -127.716 Base-Backbone interact. energy: -0.430 local terms energy: -126.259390 where: bonds (distance) C4'-P energy: -25.291 bonds (distance) P-C4' energy: -24.034 flat angles C4'-P-C4' energy: -27.288 flat angles P-C4'-P energy: -23.198 tors. eta vs tors. theta energy: -26.449 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 50 Temperature: 1.000000 Total energy: -459.962653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.962653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.962653 (E_RNA) where: Base-Base interactions energy: -317.726 where: short stacking energy: -144.481 Base-Backbone interact. energy: -0.513 local terms energy: -141.722990 where: bonds (distance) C4'-P energy: -25.568 bonds (distance) P-C4' energy: -28.941 flat angles C4'-P-C4' energy: -27.835 flat angles P-C4'-P energy: -18.069 tors. eta vs tors. theta energy: -41.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 50 Temperature: 1.050000 Total energy: -407.652296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.652296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.652296 (E_RNA) where: Base-Base interactions energy: -276.922 where: short stacking energy: -131.045 Base-Backbone interact. energy: -0.255 local terms energy: -130.475156 where: bonds (distance) C4'-P energy: -24.823 bonds (distance) P-C4' energy: -24.160 flat angles C4'-P-C4' energy: -26.446 flat angles P-C4'-P energy: -21.481 tors. eta vs tors. theta energy: -33.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 50 Temperature: 1.100000 Total energy: -358.363198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.363198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.363198 (E_RNA) where: Base-Base interactions energy: -234.433 where: short stacking energy: -113.674 Base-Backbone interact. energy: -0.210 local terms energy: -123.720362 where: bonds (distance) C4'-P energy: -20.618 bonds (distance) P-C4' energy: -21.896 flat angles C4'-P-C4' energy: -29.330 flat angles P-C4'-P energy: -19.379 tors. eta vs tors. theta energy: -32.497 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 6 ===================================== Write number: 50 Temperature: 1.150000 Total energy: -315.571169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.571169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.571169 (E_RNA) where: Base-Base interactions energy: -191.655 where: short stacking energy: -91.187 Base-Backbone interact. energy: 0.177 local terms energy: -124.093159 where: bonds (distance) C4'-P energy: -28.545 bonds (distance) P-C4' energy: -27.709 flat angles C4'-P-C4' energy: -22.976 flat angles P-C4'-P energy: -19.602 tors. eta vs tors. theta energy: -25.262 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 50 Temperature: 1.200000 Total energy: -358.513717 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.513717 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.513717 (E_RNA) where: Base-Base interactions energy: -263.852 where: short stacking energy: -108.011 Base-Backbone interact. energy: -0.557 local terms energy: -94.104780 where: bonds (distance) C4'-P energy: -18.483 bonds (distance) P-C4' energy: -22.093 flat angles C4'-P-C4' energy: -16.693 flat angles P-C4'-P energy: -7.598 tors. eta vs tors. theta energy: -29.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 50 Temperature: 1.250000 Total energy: -244.559502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.559502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.559502 (E_RNA) where: Base-Base interactions energy: -157.562 where: short stacking energy: -76.530 Base-Backbone interact. energy: 0.227 local terms energy: -87.224271 where: bonds (distance) C4'-P energy: -17.913 bonds (distance) P-C4' energy: -21.437 flat angles C4'-P-C4' energy: -19.995 flat angles P-C4'-P energy: -11.113 tors. eta vs tors. theta energy: -16.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 50 Temperature: 1.300000 Total energy: -230.932319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.932319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.932319 (E_RNA) where: Base-Base interactions energy: -140.847 where: short stacking energy: -83.922 Base-Backbone interact. energy: -0.052 local terms energy: -90.033436 where: bonds (distance) C4'-P energy: -14.733 bonds (distance) P-C4' energy: -25.304 flat angles C4'-P-C4' energy: -25.301 flat angles P-C4'-P energy: -9.953 tors. eta vs tors. theta energy: -14.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 50 Temperature: 1.350000 Total energy: -224.032808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.032808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.032808 (E_RNA) where: Base-Base interactions energy: -133.392 where: short stacking energy: -68.480 Base-Backbone interact. energy: -0.284 local terms energy: -90.356508 where: bonds (distance) C4'-P energy: -28.260 bonds (distance) P-C4' energy: -25.944 flat angles C4'-P-C4' energy: -19.516 flat angles P-C4'-P energy: -9.949 tors. eta vs tors. theta energy: -6.687 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 51 Temperature: 0.900000 Total energy: -474.575854 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.575854 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.575854 (E_RNA) where: Base-Base interactions energy: -327.548 where: short stacking energy: -143.620 Base-Backbone interact. energy: -0.242 local terms energy: -146.785675 where: bonds (distance) C4'-P energy: -23.619 bonds (distance) P-C4' energy: -29.123 flat angles C4'-P-C4' energy: -29.809 flat angles P-C4'-P energy: -20.057 tors. eta vs tors. theta energy: -44.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 51 Temperature: 0.950000 Total energy: -455.290994 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.290994 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.290994 (E_RNA) where: Base-Base interactions energy: -317.119 where: short stacking energy: -145.739 Base-Backbone interact. energy: -0.716 local terms energy: -137.456792 where: bonds (distance) C4'-P energy: -26.239 bonds (distance) P-C4' energy: -23.468 flat angles C4'-P-C4' energy: -27.454 flat angles P-C4'-P energy: -18.453 tors. eta vs tors. theta energy: -41.843 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 51 Temperature: 1.000000 Total energy: -422.641924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.641924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.641924 (E_RNA) where: Base-Base interactions energy: -308.710 where: short stacking energy: -120.882 Base-Backbone interact. energy: 0.763 local terms energy: -114.694784 where: bonds (distance) C4'-P energy: -19.817 bonds (distance) P-C4' energy: -21.093 flat angles C4'-P-C4' energy: -23.063 flat angles P-C4'-P energy: -20.383 tors. eta vs tors. theta energy: -30.338 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 51 Temperature: 1.050000 Total energy: -412.188617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.188617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.188617 (E_RNA) where: Base-Base interactions energy: -280.015 where: short stacking energy: -117.842 Base-Backbone interact. energy: -0.528 local terms energy: -131.645877 where: bonds (distance) C4'-P energy: -24.252 bonds (distance) P-C4' energy: -27.969 flat angles C4'-P-C4' energy: -23.197 flat angles P-C4'-P energy: -22.293 tors. eta vs tors. theta energy: -33.935 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 51 Temperature: 1.100000 Total energy: -361.278452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.278452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.278452 (E_RNA) where: Base-Base interactions energy: -249.957 where: short stacking energy: -110.993 Base-Backbone interact. energy: -0.271 local terms energy: -111.050899 where: bonds (distance) C4'-P energy: -21.987 bonds (distance) P-C4' energy: -11.162 flat angles C4'-P-C4' energy: -28.628 flat angles P-C4'-P energy: -19.160 tors. eta vs tors. theta energy: -30.114 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 51 Temperature: 1.150000 Total energy: -342.487134 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -342.487134 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -342.487134 (E_RNA) where: Base-Base interactions energy: -223.939 where: short stacking energy: -96.516 Base-Backbone interact. energy: -0.626 local terms energy: -117.921930 where: bonds (distance) C4'-P energy: -28.786 bonds (distance) P-C4' energy: -26.058 flat angles C4'-P-C4' energy: -27.122 flat angles P-C4'-P energy: -16.803 tors. eta vs tors. theta energy: -19.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 51 Temperature: 1.200000 Total energy: -328.451968 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.451968 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.451968 (E_RNA) where: Base-Base interactions energy: -213.839 where: short stacking energy: -99.443 Base-Backbone interact. energy: -1.046 local terms energy: -113.566703 where: bonds (distance) C4'-P energy: -24.315 bonds (distance) P-C4' energy: -24.964 flat angles C4'-P-C4' energy: -25.957 flat angles P-C4'-P energy: -15.979 tors. eta vs tors. theta energy: -22.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 51 Temperature: 1.250000 Total energy: -261.944382 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.944382 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.944382 (E_RNA) where: Base-Base interactions energy: -159.028 where: short stacking energy: -85.368 Base-Backbone interact. energy: -0.089 local terms energy: -102.827921 where: bonds (distance) C4'-P energy: -27.044 bonds (distance) P-C4' energy: -26.626 flat angles C4'-P-C4' energy: -20.384 flat angles P-C4'-P energy: -13.705 tors. eta vs tors. theta energy: -15.068 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 51 Temperature: 1.300000 Total energy: -228.327405 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.327405 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.327405 (E_RNA) where: Base-Base interactions energy: -126.600 where: short stacking energy: -75.819 Base-Backbone interact. energy: -0.373 local terms energy: -101.354548 where: bonds (distance) C4'-P energy: -17.892 bonds (distance) P-C4' energy: -24.952 flat angles C4'-P-C4' energy: -26.499 flat angles P-C4'-P energy: -11.072 tors. eta vs tors. theta energy: -20.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 51 Temperature: 1.350000 Total energy: -203.993664 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -203.993664 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -203.993664 (E_RNA) where: Base-Base interactions energy: -115.112 where: short stacking energy: -55.007 Base-Backbone interact. energy: -0.078 local terms energy: -88.803815 where: bonds (distance) C4'-P energy: -22.431 bonds (distance) P-C4' energy: -24.269 flat angles C4'-P-C4' energy: -25.470 flat angles P-C4'-P energy: -13.798 tors. eta vs tors. theta energy: -2.836 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 52 Temperature: 0.900000 Total energy: -460.248548 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.248548 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.248548 (E_RNA) where: Base-Base interactions energy: -316.585 where: short stacking energy: -151.376 Base-Backbone interact. energy: -0.457 local terms energy: -143.205985 where: bonds (distance) C4'-P energy: -25.175 bonds (distance) P-C4' energy: -24.113 flat angles C4'-P-C4' energy: -29.012 flat angles P-C4'-P energy: -19.774 tors. eta vs tors. theta energy: -45.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 52 Temperature: 0.950000 Total energy: -458.229841 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.229841 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.229841 (E_RNA) where: Base-Base interactions energy: -312.508 where: short stacking energy: -148.020 Base-Backbone interact. energy: -0.588 local terms energy: -145.133111 where: bonds (distance) C4'-P energy: -26.624 bonds (distance) P-C4' energy: -30.082 flat angles C4'-P-C4' energy: -30.020 flat angles P-C4'-P energy: -14.591 tors. eta vs tors. theta energy: -43.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 52 Temperature: 1.000000 Total energy: -443.665603 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.665603 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.665603 (E_RNA) where: Base-Base interactions energy: -315.219 where: short stacking energy: -129.247 Base-Backbone interact. energy: -0.448 local terms energy: -127.997991 where: bonds (distance) C4'-P energy: -24.839 bonds (distance) P-C4' energy: -22.920 flat angles C4'-P-C4' energy: -24.699 flat angles P-C4'-P energy: -19.406 tors. eta vs tors. theta energy: -36.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 52 Temperature: 1.050000 Total energy: -411.394227 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.394227 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.394227 (E_RNA) where: Base-Base interactions energy: -274.562 where: short stacking energy: -120.037 Base-Backbone interact. energy: -1.266 local terms energy: -135.565968 where: bonds (distance) C4'-P energy: -27.468 bonds (distance) P-C4' energy: -27.573 flat angles C4'-P-C4' energy: -26.951 flat angles P-C4'-P energy: -21.801 tors. eta vs tors. theta energy: -31.773 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 52 Temperature: 1.100000 Total energy: -387.001029 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -387.001029 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -387.001029 (E_RNA) where: Base-Base interactions energy: -258.028 where: short stacking energy: -116.425 Base-Backbone interact. energy: -0.391 local terms energy: -128.582556 where: bonds (distance) C4'-P energy: -24.447 bonds (distance) P-C4' energy: -23.632 flat angles C4'-P-C4' energy: -28.756 flat angles P-C4'-P energy: -18.297 tors. eta vs tors. theta energy: -33.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 52 Temperature: 1.150000 Total energy: -361.871277 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.871277 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.871277 (E_RNA) where: Base-Base interactions energy: -234.267 where: short stacking energy: -119.116 Base-Backbone interact. energy: -1.956 local terms energy: -125.647990 where: bonds (distance) C4'-P energy: -23.485 bonds (distance) P-C4' energy: -27.447 flat angles C4'-P-C4' energy: -28.436 flat angles P-C4'-P energy: -20.292 tors. eta vs tors. theta energy: -25.988 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 52 Temperature: 1.200000 Total energy: -241.513358 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.513358 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.513358 (E_RNA) where: Base-Base interactions energy: -138.460 where: short stacking energy: -84.874 Base-Backbone interact. energy: 0.673 local terms energy: -103.726272 where: bonds (distance) C4'-P energy: -22.299 bonds (distance) P-C4' energy: -24.472 flat angles C4'-P-C4' energy: -19.327 flat angles P-C4'-P energy: -21.088 tors. eta vs tors. theta energy: -16.540 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 52 Temperature: 1.250000 Total energy: -254.830690 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.830690 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.830690 (E_RNA) where: Base-Base interactions energy: -149.252 where: short stacking energy: -75.675 Base-Backbone interact. energy: -0.071 local terms energy: -105.506993 where: bonds (distance) C4'-P energy: -18.843 bonds (distance) P-C4' energy: -28.213 flat angles C4'-P-C4' energy: -22.636 flat angles P-C4'-P energy: -20.368 tors. eta vs tors. theta energy: -15.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 52 Temperature: 1.300000 Total energy: -237.485293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.485293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.485293 (E_RNA) where: Base-Base interactions energy: -147.831 where: short stacking energy: -86.737 Base-Backbone interact. energy: 0.210 local terms energy: -89.864235 where: bonds (distance) C4'-P energy: -21.748 bonds (distance) P-C4' energy: -19.835 flat angles C4'-P-C4' energy: -19.393 flat angles P-C4'-P energy: -15.270 tors. eta vs tors. theta energy: -13.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 52 Temperature: 1.350000 Total energy: -214.168853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.168853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.168853 (E_RNA) where: Base-Base interactions energy: -119.186 where: short stacking energy: -63.118 Base-Backbone interact. energy: -0.283 local terms energy: -94.699901 where: bonds (distance) C4'-P energy: -13.110 bonds (distance) P-C4' energy: -26.698 flat angles C4'-P-C4' energy: -23.646 flat angles P-C4'-P energy: -22.974 tors. eta vs tors. theta energy: -8.272 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 53 Temperature: 0.900000 Total energy: -466.425726 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.425726 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.425726 (E_RNA) where: Base-Base interactions energy: -321.937 where: short stacking energy: -152.938 Base-Backbone interact. energy: -0.451 local terms energy: -144.037579 where: bonds (distance) C4'-P energy: -24.790 bonds (distance) P-C4' energy: -26.500 flat angles C4'-P-C4' energy: -28.357 flat angles P-C4'-P energy: -22.720 tors. eta vs tors. theta energy: -41.670 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 53 Temperature: 0.950000 Total energy: -451.286527 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.286527 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.286527 (E_RNA) where: Base-Base interactions energy: -308.783 where: short stacking energy: -142.166 Base-Backbone interact. energy: -0.022 local terms energy: -142.481389 where: bonds (distance) C4'-P energy: -26.420 bonds (distance) P-C4' energy: -26.647 flat angles C4'-P-C4' energy: -31.446 flat angles P-C4'-P energy: -15.250 tors. eta vs tors. theta energy: -42.718 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 53 Temperature: 1.000000 Total energy: -444.648299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.648299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.648299 (E_RNA) where: Base-Base interactions energy: -306.353 where: short stacking energy: -112.384 Base-Backbone interact. energy: 0.153 local terms energy: -138.448386 where: bonds (distance) C4'-P energy: -28.887 bonds (distance) P-C4' energy: -24.629 flat angles C4'-P-C4' energy: -28.717 flat angles P-C4'-P energy: -21.486 tors. eta vs tors. theta energy: -34.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 53 Temperature: 1.050000 Total energy: -404.732145 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.732145 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.732145 (E_RNA) where: Base-Base interactions energy: -266.024 where: short stacking energy: -120.334 Base-Backbone interact. energy: -0.707 local terms energy: -138.001337 where: bonds (distance) C4'-P energy: -30.468 bonds (distance) P-C4' energy: -24.798 flat angles C4'-P-C4' energy: -26.734 flat angles P-C4'-P energy: -19.802 tors. eta vs tors. theta energy: -36.199 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 53 Temperature: 1.100000 Total energy: -339.088886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -339.088886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -339.088886 (E_RNA) where: Base-Base interactions energy: -228.444 where: short stacking energy: -109.744 Base-Backbone interact. energy: -1.070 local terms energy: -109.575022 where: bonds (distance) C4'-P energy: -22.746 bonds (distance) P-C4' energy: -23.984 flat angles C4'-P-C4' energy: -28.890 flat angles P-C4'-P energy: -14.433 tors. eta vs tors. theta energy: -19.522 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 53 Temperature: 1.150000 Total energy: -369.105228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -369.105228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -369.105228 (E_RNA) where: Base-Base interactions energy: -243.336 where: short stacking energy: -118.188 Base-Backbone interact. energy: -0.898 local terms energy: -124.870715 where: bonds (distance) C4'-P energy: -29.430 bonds (distance) P-C4' energy: -22.071 flat angles C4'-P-C4' energy: -22.048 flat angles P-C4'-P energy: -21.229 tors. eta vs tors. theta energy: -30.093 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 53 Temperature: 1.200000 Total energy: -257.603438 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.603438 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.603438 (E_RNA) where: Base-Base interactions energy: -156.175 where: short stacking energy: -86.932 Base-Backbone interact. energy: -0.233 local terms energy: -101.194500 where: bonds (distance) C4'-P energy: -18.297 bonds (distance) P-C4' energy: -24.472 flat angles C4'-P-C4' energy: -24.143 flat angles P-C4'-P energy: -19.320 tors. eta vs tors. theta energy: -14.963 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 53 Temperature: 1.250000 Total energy: -226.430898 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.430898 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.430898 (E_RNA) where: Base-Base interactions energy: -129.954 where: short stacking energy: -62.928 Base-Backbone interact. energy: -1.730 local terms energy: -94.747361 where: bonds (distance) C4'-P energy: -23.962 bonds (distance) P-C4' energy: -23.964 flat angles C4'-P-C4' energy: -20.004 flat angles P-C4'-P energy: -14.026 tors. eta vs tors. theta energy: -12.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 53 Temperature: 1.300000 Total energy: -226.021026 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.021026 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.021026 (E_RNA) where: Base-Base interactions energy: -133.149 where: short stacking energy: -69.567 Base-Backbone interact. energy: 0.422 local terms energy: -93.293387 where: bonds (distance) C4'-P energy: -17.687 bonds (distance) P-C4' energy: -25.287 flat angles C4'-P-C4' energy: -18.010 flat angles P-C4'-P energy: -12.779 tors. eta vs tors. theta energy: -19.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 53 Temperature: 1.350000 Total energy: -217.814810 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.814810 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.814810 (E_RNA) where: Base-Base interactions energy: -125.612 where: short stacking energy: -61.775 Base-Backbone interact. energy: 0.800 local terms energy: -93.002544 where: bonds (distance) C4'-P energy: -22.360 bonds (distance) P-C4' energy: -29.443 flat angles C4'-P-C4' energy: -18.298 flat angles P-C4'-P energy: -8.833 tors. eta vs tors. theta energy: -14.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 54 Temperature: 0.900000 Total energy: -475.195028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.195028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.195028 (E_RNA) where: Base-Base interactions energy: -330.658 where: short stacking energy: -152.892 Base-Backbone interact. energy: -0.437 local terms energy: -144.099660 where: bonds (distance) C4'-P energy: -26.906 bonds (distance) P-C4' energy: -24.753 flat angles C4'-P-C4' energy: -29.448 flat angles P-C4'-P energy: -18.197 tors. eta vs tors. theta energy: -44.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 54 Temperature: 0.950000 Total energy: -461.049765 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.049765 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.049765 (E_RNA) where: Base-Base interactions energy: -318.484 where: short stacking energy: -148.571 Base-Backbone interact. energy: -0.145 local terms energy: -142.420628 where: bonds (distance) C4'-P energy: -26.404 bonds (distance) P-C4' energy: -26.755 flat angles C4'-P-C4' energy: -29.205 flat angles P-C4'-P energy: -18.170 tors. eta vs tors. theta energy: -41.887 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 54 Temperature: 1.000000 Total energy: -444.308475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.308475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.308475 (E_RNA) where: Base-Base interactions energy: -317.515 where: short stacking energy: -118.854 Base-Backbone interact. energy: 1.091 local terms energy: -127.884401 where: bonds (distance) C4'-P energy: -22.552 bonds (distance) P-C4' energy: -26.040 flat angles C4'-P-C4' energy: -22.725 flat angles P-C4'-P energy: -21.865 tors. eta vs tors. theta energy: -34.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 54 Temperature: 1.050000 Total energy: -404.401002 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.401002 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.401002 (E_RNA) where: Base-Base interactions energy: -276.214 where: short stacking energy: -129.742 Base-Backbone interact. energy: -1.351 local terms energy: -126.836663 where: bonds (distance) C4'-P energy: -29.994 bonds (distance) P-C4' energy: -21.890 flat angles C4'-P-C4' energy: -23.435 flat angles P-C4'-P energy: -17.186 tors. eta vs tors. theta energy: -34.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 54 Temperature: 1.100000 Total energy: -383.962595 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.962595 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.962595 (E_RNA) where: Base-Base interactions energy: -263.669 where: short stacking energy: -132.311 Base-Backbone interact. energy: 0.132 local terms energy: -120.425221 where: bonds (distance) C4'-P energy: -20.744 bonds (distance) P-C4' energy: -21.840 flat angles C4'-P-C4' energy: -26.243 flat angles P-C4'-P energy: -14.947 tors. eta vs tors. theta energy: -36.651 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 54 Temperature: 1.150000 Total energy: -340.090441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -340.090441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -340.090441 (E_RNA) where: Base-Base interactions energy: -218.360 where: short stacking energy: -105.309 Base-Backbone interact. energy: -1.610 local terms energy: -120.120493 where: bonds (distance) C4'-P energy: -21.606 bonds (distance) P-C4' energy: -24.885 flat angles C4'-P-C4' energy: -25.781 flat angles P-C4'-P energy: -22.191 tors. eta vs tors. theta energy: -25.658 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 54 Temperature: 1.200000 Total energy: -235.953605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.953605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.953605 (E_RNA) where: Base-Base interactions energy: -138.292 where: short stacking energy: -72.597 Base-Backbone interact. energy: -0.466 local terms energy: -97.195450 where: bonds (distance) C4'-P energy: -28.668 bonds (distance) P-C4' energy: -21.338 flat angles C4'-P-C4' energy: -28.289 flat angles P-C4'-P energy: -11.889 tors. eta vs tors. theta energy: -7.011 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 54 Temperature: 1.250000 Total energy: -264.923871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.923871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.923871 (E_RNA) where: Base-Base interactions energy: -168.970 where: short stacking energy: -84.912 Base-Backbone interact. energy: -1.104 local terms energy: -94.850300 where: bonds (distance) C4'-P energy: -21.866 bonds (distance) P-C4' energy: -22.460 flat angles C4'-P-C4' energy: -15.317 flat angles P-C4'-P energy: -13.650 tors. eta vs tors. theta energy: -21.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 54 Temperature: 1.300000 Total energy: -245.043160 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.043160 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.043160 (E_RNA) where: Base-Base interactions energy: -152.300 where: short stacking energy: -84.153 Base-Backbone interact. energy: -0.445 local terms energy: -92.298428 where: bonds (distance) C4'-P energy: -22.371 bonds (distance) P-C4' energy: -19.696 flat angles C4'-P-C4' energy: -19.932 flat angles P-C4'-P energy: -16.025 tors. eta vs tors. theta energy: -14.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 54 Temperature: 1.350000 Total energy: -229.311912 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.311912 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.311912 (E_RNA) where: Base-Base interactions energy: -137.328 where: short stacking energy: -60.362 Base-Backbone interact. energy: 0.527 local terms energy: -92.510977 where: bonds (distance) C4'-P energy: -21.109 bonds (distance) P-C4' energy: -27.902 flat angles C4'-P-C4' energy: -20.608 flat angles P-C4'-P energy: -12.748 tors. eta vs tors. theta energy: -10.145 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 55 Temperature: 0.900000 Total energy: -475.733924 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -475.733924 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -475.733924 (E_RNA) where: Base-Base interactions energy: -324.940 where: short stacking energy: -144.488 Base-Backbone interact. energy: -1.710 local terms energy: -149.083596 where: bonds (distance) C4'-P energy: -28.122 bonds (distance) P-C4' energy: -28.369 flat angles C4'-P-C4' energy: -29.947 flat angles P-C4'-P energy: -19.763 tors. eta vs tors. theta energy: -42.882 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 55 Temperature: 0.950000 Total energy: -459.555993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.555993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.555993 (E_RNA) where: Base-Base interactions energy: -327.668 where: short stacking energy: -133.506 Base-Backbone interact. energy: 2.153 local terms energy: -134.041037 where: bonds (distance) C4'-P energy: -20.499 bonds (distance) P-C4' energy: -27.912 flat angles C4'-P-C4' energy: -26.879 flat angles P-C4'-P energy: -22.778 tors. eta vs tors. theta energy: -35.973 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 55 Temperature: 1.000000 Total energy: -443.572049 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -443.572049 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -443.572049 (E_RNA) where: Base-Base interactions energy: -301.612 where: short stacking energy: -141.598 Base-Backbone interact. energy: 0.087 local terms energy: -142.047664 where: bonds (distance) C4'-P energy: -28.101 bonds (distance) P-C4' energy: -21.844 flat angles C4'-P-C4' energy: -27.217 flat angles P-C4'-P energy: -23.795 tors. eta vs tors. theta energy: -41.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 55 Temperature: 1.050000 Total energy: -408.118914 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.118914 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.118914 (E_RNA) where: Base-Base interactions energy: -277.250 where: short stacking energy: -124.865 Base-Backbone interact. energy: 0.046 local terms energy: -130.915017 where: bonds (distance) C4'-P energy: -26.803 bonds (distance) P-C4' energy: -28.087 flat angles C4'-P-C4' energy: -26.027 flat angles P-C4'-P energy: -12.433 tors. eta vs tors. theta energy: -37.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 55 Temperature: 1.100000 Total energy: -392.799523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.799523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.799523 (E_RNA) where: Base-Base interactions energy: -262.138 where: short stacking energy: -133.037 Base-Backbone interact. energy: -2.189 local terms energy: -128.472376 where: bonds (distance) C4'-P energy: -25.150 bonds (distance) P-C4' energy: -23.721 flat angles C4'-P-C4' energy: -25.903 flat angles P-C4'-P energy: -19.509 tors. eta vs tors. theta energy: -34.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 55 Temperature: 1.150000 Total energy: -352.317871 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.317871 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.317871 (E_RNA) where: Base-Base interactions energy: -227.981 where: short stacking energy: -106.448 Base-Backbone interact. energy: -0.073 local terms energy: -124.263147 where: bonds (distance) C4'-P energy: -25.474 bonds (distance) P-C4' energy: -18.987 flat angles C4'-P-C4' energy: -26.264 flat angles P-C4'-P energy: -22.635 tors. eta vs tors. theta energy: -30.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 55 Temperature: 1.200000 Total energy: -261.866150 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -261.866150 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -261.866150 (E_RNA) where: Base-Base interactions energy: -158.293 where: short stacking energy: -78.125 Base-Backbone interact. energy: -0.954 local terms energy: -102.618877 where: bonds (distance) C4'-P energy: -29.187 bonds (distance) P-C4' energy: -23.424 flat angles C4'-P-C4' energy: -25.108 flat angles P-C4'-P energy: -12.793 tors. eta vs tors. theta energy: -12.107 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 55 Temperature: 1.250000 Total energy: -256.257017 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -256.257017 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -256.257017 (E_RNA) where: Base-Base interactions energy: -154.672 where: short stacking energy: -76.161 Base-Backbone interact. energy: -0.552 local terms energy: -101.032494 where: bonds (distance) C4'-P energy: -23.514 bonds (distance) P-C4' energy: -27.892 flat angles C4'-P-C4' energy: -26.443 flat angles P-C4'-P energy: -9.690 tors. eta vs tors. theta energy: -13.493 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 55 Temperature: 1.300000 Total energy: -246.406520 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.406520 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.406520 (E_RNA) where: Base-Base interactions energy: -153.076 where: short stacking energy: -69.412 Base-Backbone interact. energy: -0.335 local terms energy: -92.995024 where: bonds (distance) C4'-P energy: -22.199 bonds (distance) P-C4' energy: -20.447 flat angles C4'-P-C4' energy: -21.961 flat angles P-C4'-P energy: -16.129 tors. eta vs tors. theta energy: -12.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 55 Temperature: 1.350000 Total energy: -229.724530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.724530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.724530 (E_RNA) where: Base-Base interactions energy: -133.795 where: short stacking energy: -65.254 Base-Backbone interact. energy: 0.938 local terms energy: -96.866922 where: bonds (distance) C4'-P energy: -23.610 bonds (distance) P-C4' energy: -25.397 flat angles C4'-P-C4' energy: -24.684 flat angles P-C4'-P energy: -11.715 tors. eta vs tors. theta energy: -11.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 56 Temperature: 0.900000 Total energy: -474.351689 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.351689 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.351689 (E_RNA) where: Base-Base interactions energy: -334.293 where: short stacking energy: -134.397 Base-Backbone interact. energy: -0.875 local terms energy: -139.183327 where: bonds (distance) C4'-P energy: -28.610 bonds (distance) P-C4' energy: -24.744 flat angles C4'-P-C4' energy: -28.216 flat angles P-C4'-P energy: -21.227 tors. eta vs tors. theta energy: -36.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 56 Temperature: 0.950000 Total energy: -472.268574 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -472.268574 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -472.268574 (E_RNA) where: Base-Base interactions energy: -328.007 where: short stacking energy: -138.804 Base-Backbone interact. energy: -0.018 local terms energy: -144.242959 where: bonds (distance) C4'-P energy: -30.573 bonds (distance) P-C4' energy: -28.268 flat angles C4'-P-C4' energy: -30.272 flat angles P-C4'-P energy: -14.354 tors. eta vs tors. theta energy: -40.776 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 56 Temperature: 1.000000 Total energy: -426.857032 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.857032 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.857032 (E_RNA) where: Base-Base interactions energy: -305.226 where: short stacking energy: -140.634 Base-Backbone interact. energy: 1.008 local terms energy: -122.639124 where: bonds (distance) C4'-P energy: -22.420 bonds (distance) P-C4' energy: -27.680 flat angles C4'-P-C4' energy: -30.540 flat angles P-C4'-P energy: -5.773 tors. eta vs tors. theta energy: -36.226 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 56 Temperature: 1.050000 Total energy: -449.409303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.409303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.409303 (E_RNA) where: Base-Base interactions energy: -309.434 where: short stacking energy: -143.067 Base-Backbone interact. energy: -2.232 local terms energy: -137.743856 where: bonds (distance) C4'-P energy: -26.537 bonds (distance) P-C4' energy: -21.479 flat angles C4'-P-C4' energy: -29.034 flat angles P-C4'-P energy: -18.173 tors. eta vs tors. theta energy: -42.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 56 Temperature: 1.100000 Total energy: -375.085984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.085984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.085984 (E_RNA) where: Base-Base interactions energy: -257.187 where: short stacking energy: -114.116 Base-Backbone interact. energy: -0.437 local terms energy: -117.462335 where: bonds (distance) C4'-P energy: -20.992 bonds (distance) P-C4' energy: -28.328 flat angles C4'-P-C4' energy: -22.029 flat angles P-C4'-P energy: -20.433 tors. eta vs tors. theta energy: -25.680 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 56 Temperature: 1.150000 Total energy: -420.087721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -420.087721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -420.087721 (E_RNA) where: Base-Base interactions energy: -289.119 where: short stacking energy: -126.649 Base-Backbone interact. energy: -0.646 local terms energy: -130.322578 where: bonds (distance) C4'-P energy: -19.515 bonds (distance) P-C4' energy: -22.188 flat angles C4'-P-C4' energy: -27.935 flat angles P-C4'-P energy: -21.333 tors. eta vs tors. theta energy: -39.352 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 56 Temperature: 1.200000 Total energy: -247.645393 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.645393 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.645393 (E_RNA) where: Base-Base interactions energy: -147.656 where: short stacking energy: -87.211 Base-Backbone interact. energy: 0.789 local terms energy: -100.778205 where: bonds (distance) C4'-P energy: -22.501 bonds (distance) P-C4' energy: -27.221 flat angles C4'-P-C4' energy: -23.348 flat angles P-C4'-P energy: -11.485 tors. eta vs tors. theta energy: -16.223 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 56 Temperature: 1.250000 Total energy: -253.283606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.283606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.283606 (E_RNA) where: Base-Base interactions energy: -155.478 where: short stacking energy: -82.588 Base-Backbone interact. energy: -0.251 local terms energy: -97.555096 where: bonds (distance) C4'-P energy: -27.442 bonds (distance) P-C4' energy: -24.409 flat angles C4'-P-C4' energy: -21.431 flat angles P-C4'-P energy: -10.684 tors. eta vs tors. theta energy: -13.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 56 Temperature: 1.300000 Total energy: -254.125515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.125515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.125515 (E_RNA) where: Base-Base interactions energy: -156.069 where: short stacking energy: -63.980 Base-Backbone interact. energy: 0.763 local terms energy: -98.819165 where: bonds (distance) C4'-P energy: -26.967 bonds (distance) P-C4' energy: -23.220 flat angles C4'-P-C4' energy: -21.810 flat angles P-C4'-P energy: -16.861 tors. eta vs tors. theta energy: -9.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 56 Temperature: 1.350000 Total energy: -227.987944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.987944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.987944 (E_RNA) where: Base-Base interactions energy: -135.234 where: short stacking energy: -72.306 Base-Backbone interact. energy: -0.300 local terms energy: -92.453138 where: bonds (distance) C4'-P energy: -20.720 bonds (distance) P-C4' energy: -26.320 flat angles C4'-P-C4' energy: -26.257 flat angles P-C4'-P energy: -5.712 tors. eta vs tors. theta energy: -13.445 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 57 Temperature: 0.900000 Total energy: -469.558350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.558350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.558350 (E_RNA) where: Base-Base interactions energy: -327.050 where: short stacking energy: -130.471 Base-Backbone interact. energy: -1.038 local terms energy: -141.470791 where: bonds (distance) C4'-P energy: -22.992 bonds (distance) P-C4' energy: -28.020 flat angles C4'-P-C4' energy: -29.665 flat angles P-C4'-P energy: -19.849 tors. eta vs tors. theta energy: -40.945 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 57 Temperature: 0.950000 Total energy: -423.964333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.964333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.964333 (E_RNA) where: Base-Base interactions energy: -286.679 where: short stacking energy: -126.487 Base-Backbone interact. energy: -1.681 local terms energy: -135.604731 where: bonds (distance) C4'-P energy: -23.672 bonds (distance) P-C4' energy: -30.223 flat angles C4'-P-C4' energy: -30.526 flat angles P-C4'-P energy: -18.355 tors. eta vs tors. theta energy: -32.830 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 57 Temperature: 1.000000 Total energy: -445.371629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.371629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.371629 (E_RNA) where: Base-Base interactions energy: -309.929 where: short stacking energy: -145.603 Base-Backbone interact. energy: -0.031 local terms energy: -135.411940 where: bonds (distance) C4'-P energy: -24.581 bonds (distance) P-C4' energy: -25.386 flat angles C4'-P-C4' energy: -26.256 flat angles P-C4'-P energy: -19.493 tors. eta vs tors. theta energy: -39.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 57 Temperature: 1.050000 Total energy: -441.410751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.410751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.410751 (E_RNA) where: Base-Base interactions energy: -312.700 where: short stacking energy: -136.835 Base-Backbone interact. energy: -0.266 local terms energy: -128.443983 where: bonds (distance) C4'-P energy: -26.380 bonds (distance) P-C4' energy: -17.519 flat angles C4'-P-C4' energy: -30.161 flat angles P-C4'-P energy: -15.815 tors. eta vs tors. theta energy: -38.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 57 Temperature: 1.100000 Total energy: -372.318831 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -372.318831 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -372.318831 (E_RNA) where: Base-Base interactions energy: -263.391 where: short stacking energy: -111.144 Base-Backbone interact. energy: -0.275 local terms energy: -108.652715 where: bonds (distance) C4'-P energy: -22.004 bonds (distance) P-C4' energy: -24.469 flat angles C4'-P-C4' energy: -22.617 flat angles P-C4'-P energy: -6.714 tors. eta vs tors. theta energy: -32.850 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 4 ===================================== Write number: 57 Temperature: 1.150000 Total energy: -412.706352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.706352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.706352 (E_RNA) where: Base-Base interactions energy: -288.813 where: short stacking energy: -132.811 Base-Backbone interact. energy: -0.614 local terms energy: -123.279336 where: bonds (distance) C4'-P energy: -20.911 bonds (distance) P-C4' energy: -27.117 flat angles C4'-P-C4' energy: -28.747 flat angles P-C4'-P energy: -14.415 tors. eta vs tors. theta energy: -32.089 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 57 Temperature: 1.200000 Total energy: -250.131477 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -250.131477 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -250.131477 (E_RNA) where: Base-Base interactions energy: -149.306 where: short stacking energy: -76.889 Base-Backbone interact. energy: -2.594 local terms energy: -98.230771 where: bonds (distance) C4'-P energy: -24.920 bonds (distance) P-C4' energy: -16.319 flat angles C4'-P-C4' energy: -18.073 flat angles P-C4'-P energy: -22.070 tors. eta vs tors. theta energy: -16.849 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 57 Temperature: 1.250000 Total energy: -274.197170 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.197170 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.197170 (E_RNA) where: Base-Base interactions energy: -180.436 where: short stacking energy: -85.379 Base-Backbone interact. energy: -1.044 local terms energy: -92.717370 where: bonds (distance) C4'-P energy: -24.135 bonds (distance) P-C4' energy: -15.696 flat angles C4'-P-C4' energy: -16.402 flat angles P-C4'-P energy: -19.183 tors. eta vs tors. theta energy: -17.301 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 57 Temperature: 1.300000 Total energy: -240.703058 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.703058 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.703058 (E_RNA) where: Base-Base interactions energy: -158.350 where: short stacking energy: -82.651 Base-Backbone interact. energy: 0.590 local terms energy: -82.943327 where: bonds (distance) C4'-P energy: -20.005 bonds (distance) P-C4' energy: -19.755 flat angles C4'-P-C4' energy: -24.035 flat angles P-C4'-P energy: -7.408 tors. eta vs tors. theta energy: -11.741 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 57 Temperature: 1.350000 Total energy: -228.320413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.320413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.320413 (E_RNA) where: Base-Base interactions energy: -138.821 where: short stacking energy: -74.530 Base-Backbone interact. energy: -0.039 local terms energy: -89.460044 where: bonds (distance) C4'-P energy: -24.980 bonds (distance) P-C4' energy: -21.775 flat angles C4'-P-C4' energy: -19.043 flat angles P-C4'-P energy: -10.093 tors. eta vs tors. theta energy: -13.569 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 58 Temperature: 0.900000 Total energy: -471.013967 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.013967 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.013967 (E_RNA) where: Base-Base interactions energy: -330.356 where: short stacking energy: -130.065 Base-Backbone interact. energy: -1.452 local terms energy: -139.205833 where: bonds (distance) C4'-P energy: -26.304 bonds (distance) P-C4' energy: -28.193 flat angles C4'-P-C4' energy: -25.948 flat angles P-C4'-P energy: -21.599 tors. eta vs tors. theta energy: -37.162 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 58 Temperature: 0.950000 Total energy: -425.282738 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.282738 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.282738 (E_RNA) where: Base-Base interactions energy: -286.989 where: short stacking energy: -140.919 Base-Backbone interact. energy: -0.691 local terms energy: -137.603076 where: bonds (distance) C4'-P energy: -28.437 bonds (distance) P-C4' energy: -21.851 flat angles C4'-P-C4' energy: -31.976 flat angles P-C4'-P energy: -19.301 tors. eta vs tors. theta energy: -36.038 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 58 Temperature: 1.000000 Total energy: -451.382815 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.382815 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.382815 (E_RNA) where: Base-Base interactions energy: -310.326 where: short stacking energy: -145.524 Base-Backbone interact. energy: 0.577 local terms energy: -141.633933 where: bonds (distance) C4'-P energy: -27.209 bonds (distance) P-C4' energy: -25.540 flat angles C4'-P-C4' energy: -30.378 flat angles P-C4'-P energy: -17.794 tors. eta vs tors. theta energy: -40.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 58 Temperature: 1.050000 Total energy: -435.946081 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.946081 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.946081 (E_RNA) where: Base-Base interactions energy: -304.630 where: short stacking energy: -130.057 Base-Backbone interact. energy: -0.386 local terms energy: -130.929370 where: bonds (distance) C4'-P energy: -13.878 bonds (distance) P-C4' energy: -28.636 flat angles C4'-P-C4' energy: -27.171 flat angles P-C4'-P energy: -19.131 tors. eta vs tors. theta energy: -42.113 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 58 Temperature: 1.100000 Total energy: -429.951901 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.951901 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.951901 (E_RNA) where: Base-Base interactions energy: -301.345 where: short stacking energy: -133.598 Base-Backbone interact. energy: -0.000 local terms energy: -128.606445 where: bonds (distance) C4'-P energy: -20.214 bonds (distance) P-C4' energy: -22.743 flat angles C4'-P-C4' energy: -25.129 flat angles P-C4'-P energy: -22.090 tors. eta vs tors. theta energy: -38.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 58 Temperature: 1.150000 Total energy: -347.744998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.744998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.744998 (E_RNA) where: Base-Base interactions energy: -240.087 where: short stacking energy: -110.826 Base-Backbone interact. energy: -0.079 local terms energy: -107.579025 where: bonds (distance) C4'-P energy: -21.737 bonds (distance) P-C4' energy: -25.250 flat angles C4'-P-C4' energy: -24.423 flat angles P-C4'-P energy: -6.309 tors. eta vs tors. theta energy: -29.860 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 58 Temperature: 1.200000 Total energy: -287.138048 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.138048 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.138048 (E_RNA) where: Base-Base interactions energy: -186.805 where: short stacking energy: -93.604 Base-Backbone interact. energy: -0.380 local terms energy: -99.953865 where: bonds (distance) C4'-P energy: -28.556 bonds (distance) P-C4' energy: -18.680 flat angles C4'-P-C4' energy: -23.898 flat angles P-C4'-P energy: -14.071 tors. eta vs tors. theta energy: -14.750 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 58 Temperature: 1.250000 Total energy: -237.918575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.918575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.918575 (E_RNA) where: Base-Base interactions energy: -142.326 where: short stacking energy: -61.721 Base-Backbone interact. energy: -2.055 local terms energy: -93.537513 where: bonds (distance) C4'-P energy: -27.095 bonds (distance) P-C4' energy: -21.750 flat angles C4'-P-C4' energy: -21.708 flat angles P-C4'-P energy: -12.348 tors. eta vs tors. theta energy: -10.636 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 58 Temperature: 1.300000 Total energy: -249.190989 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.190989 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.190989 (E_RNA) where: Base-Base interactions energy: -153.450 where: short stacking energy: -83.106 Base-Backbone interact. energy: -0.619 local terms energy: -95.121703 where: bonds (distance) C4'-P energy: -11.625 bonds (distance) P-C4' energy: -24.466 flat angles C4'-P-C4' energy: -23.615 flat angles P-C4'-P energy: -20.098 tors. eta vs tors. theta energy: -15.317 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 58 Temperature: 1.350000 Total energy: -230.318531 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.318531 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.318531 (E_RNA) where: Base-Base interactions energy: -135.337 where: short stacking energy: -57.887 Base-Backbone interact. energy: -0.462 local terms energy: -94.519611 where: bonds (distance) C4'-P energy: -28.950 bonds (distance) P-C4' energy: -21.768 flat angles C4'-P-C4' energy: -21.082 flat angles P-C4'-P energy: -12.453 tors. eta vs tors. theta energy: -10.268 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 59 Temperature: 0.900000 Total energy: -471.594570 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.594570 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.594570 (E_RNA) where: Base-Base interactions energy: -330.184 where: short stacking energy: -136.971 Base-Backbone interact. energy: -1.856 local terms energy: -139.555197 where: bonds (distance) C4'-P energy: -25.916 bonds (distance) P-C4' energy: -27.035 flat angles C4'-P-C4' energy: -27.414 flat angles P-C4'-P energy: -23.437 tors. eta vs tors. theta energy: -35.753 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 59 Temperature: 0.950000 Total energy: -457.513069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.513069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.513069 (E_RNA) where: Base-Base interactions energy: -315.745 where: short stacking energy: -144.623 Base-Backbone interact. energy: 0.415 local terms energy: -142.183051 where: bonds (distance) C4'-P energy: -25.017 bonds (distance) P-C4' energy: -24.515 flat angles C4'-P-C4' energy: -25.759 flat angles P-C4'-P energy: -23.190 tors. eta vs tors. theta energy: -43.702 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 59 Temperature: 1.000000 Total energy: -432.395949 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.395949 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.395949 (E_RNA) where: Base-Base interactions energy: -293.025 where: short stacking energy: -134.559 Base-Backbone interact. energy: -1.656 local terms energy: -137.715291 where: bonds (distance) C4'-P energy: -26.517 bonds (distance) P-C4' energy: -31.379 flat angles C4'-P-C4' energy: -29.425 flat angles P-C4'-P energy: -16.370 tors. eta vs tors. theta energy: -34.026 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 59 Temperature: 1.050000 Total energy: -454.036760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.036760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.036760 (E_RNA) where: Base-Base interactions energy: -300.383 where: short stacking energy: -134.358 Base-Backbone interact. energy: -0.991 local terms energy: -152.663228 where: bonds (distance) C4'-P energy: -24.644 bonds (distance) P-C4' energy: -29.527 flat angles C4'-P-C4' energy: -31.105 flat angles P-C4'-P energy: -22.229 tors. eta vs tors. theta energy: -45.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 59 Temperature: 1.100000 Total energy: -424.576255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.576255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.576255 (E_RNA) where: Base-Base interactions energy: -293.978 where: short stacking energy: -124.545 Base-Backbone interact. energy: -0.029 local terms energy: -130.569092 where: bonds (distance) C4'-P energy: -20.303 bonds (distance) P-C4' energy: -25.199 flat angles C4'-P-C4' energy: -27.951 flat angles P-C4'-P energy: -18.091 tors. eta vs tors. theta energy: -39.025 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 59 Temperature: 1.150000 Total energy: -351.719244 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -351.719244 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -351.719244 (E_RNA) where: Base-Base interactions energy: -236.769 where: short stacking energy: -97.599 Base-Backbone interact. energy: -0.074 local terms energy: -114.875895 where: bonds (distance) C4'-P energy: -24.492 bonds (distance) P-C4' energy: -20.537 flat angles C4'-P-C4' energy: -25.922 flat angles P-C4'-P energy: -16.000 tors. eta vs tors. theta energy: -27.925 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 59 Temperature: 1.200000 Total energy: -281.101972 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.101972 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.101972 (E_RNA) where: Base-Base interactions energy: -183.672 where: short stacking energy: -67.529 Base-Backbone interact. energy: -0.285 local terms energy: -97.145071 where: bonds (distance) C4'-P energy: -26.189 bonds (distance) P-C4' energy: -23.691 flat angles C4'-P-C4' energy: -24.660 flat angles P-C4'-P energy: -11.717 tors. eta vs tors. theta energy: -10.889 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 59 Temperature: 1.250000 Total energy: -234.269744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.269744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.269744 (E_RNA) where: Base-Base interactions energy: -137.932 where: short stacking energy: -67.114 Base-Backbone interact. energy: 0.381 local terms energy: -96.718382 where: bonds (distance) C4'-P energy: -25.051 bonds (distance) P-C4' energy: -18.310 flat angles C4'-P-C4' energy: -24.326 flat angles P-C4'-P energy: -15.391 tors. eta vs tors. theta energy: -13.640 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 59 Temperature: 1.300000 Total energy: -222.789551 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.789551 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.789551 (E_RNA) where: Base-Base interactions energy: -141.282 where: short stacking energy: -72.334 Base-Backbone interact. energy: -0.329 local terms energy: -81.178083 where: bonds (distance) C4'-P energy: -19.925 bonds (distance) P-C4' energy: -26.063 flat angles C4'-P-C4' energy: -14.234 flat angles P-C4'-P energy: -15.393 tors. eta vs tors. theta energy: -5.563 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 59 Temperature: 1.350000 Total energy: -196.077743 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.077743 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.077743 (E_RNA) where: Base-Base interactions energy: -99.073 where: short stacking energy: -44.501 Base-Backbone interact. energy: 0.361 local terms energy: -97.364889 where: bonds (distance) C4'-P energy: -25.991 bonds (distance) P-C4' energy: -28.673 flat angles C4'-P-C4' energy: -22.909 flat angles P-C4'-P energy: -12.758 tors. eta vs tors. theta energy: -7.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 60 Temperature: 0.900000 Total energy: -464.910630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.910630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.910630 (E_RNA) where: Base-Base interactions energy: -326.908 where: short stacking energy: -140.789 Base-Backbone interact. energy: -0.217 local terms energy: -137.785836 where: bonds (distance) C4'-P energy: -27.908 bonds (distance) P-C4' energy: -18.821 flat angles C4'-P-C4' energy: -30.464 flat angles P-C4'-P energy: -19.601 tors. eta vs tors. theta energy: -40.993 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 60 Temperature: 0.950000 Total energy: -459.479461 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.479461 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.479461 (E_RNA) where: Base-Base interactions energy: -322.937 where: short stacking energy: -128.610 Base-Backbone interact. energy: 0.449 local terms energy: -136.991207 where: bonds (distance) C4'-P energy: -28.225 bonds (distance) P-C4' energy: -22.707 flat angles C4'-P-C4' energy: -31.516 flat angles P-C4'-P energy: -16.520 tors. eta vs tors. theta energy: -38.023 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 60 Temperature: 1.000000 Total energy: -454.784650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.784650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.784650 (E_RNA) where: Base-Base interactions energy: -312.264 where: short stacking energy: -144.913 Base-Backbone interact. energy: -2.126 local terms energy: -140.395012 where: bonds (distance) C4'-P energy: -23.150 bonds (distance) P-C4' energy: -22.829 flat angles C4'-P-C4' energy: -31.349 flat angles P-C4'-P energy: -20.185 tors. eta vs tors. theta energy: -42.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 60 Temperature: 1.050000 Total energy: -422.355424 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.355424 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.355424 (E_RNA) where: Base-Base interactions energy: -288.945 where: short stacking energy: -123.532 Base-Backbone interact. energy: -1.271 local terms energy: -132.139232 where: bonds (distance) C4'-P energy: -24.887 bonds (distance) P-C4' energy: -25.415 flat angles C4'-P-C4' energy: -32.176 flat angles P-C4'-P energy: -18.246 tors. eta vs tors. theta energy: -31.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 60 Temperature: 1.100000 Total energy: -436.908131 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.908131 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.908131 (E_RNA) where: Base-Base interactions energy: -299.193 where: short stacking energy: -127.573 Base-Backbone interact. energy: -0.047 local terms energy: -137.667597 where: bonds (distance) C4'-P energy: -19.126 bonds (distance) P-C4' energy: -28.968 flat angles C4'-P-C4' energy: -25.626 flat angles P-C4'-P energy: -20.648 tors. eta vs tors. theta energy: -43.300 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 60 Temperature: 1.150000 Total energy: -363.331613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.331613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.331613 (E_RNA) where: Base-Base interactions energy: -242.753 where: short stacking energy: -106.958 Base-Backbone interact. energy: -1.043 local terms energy: -119.535695 where: bonds (distance) C4'-P energy: -21.896 bonds (distance) P-C4' energy: -21.576 flat angles C4'-P-C4' energy: -27.755 flat angles P-C4'-P energy: -20.545 tors. eta vs tors. theta energy: -27.765 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 60 Temperature: 1.200000 Total energy: -254.993606 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -254.993606 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -254.993606 (E_RNA) where: Base-Base interactions energy: -156.664 where: short stacking energy: -87.252 Base-Backbone interact. energy: 0.530 local terms energy: -98.859738 where: bonds (distance) C4'-P energy: -21.396 bonds (distance) P-C4' energy: -18.612 flat angles C4'-P-C4' energy: -28.276 flat angles P-C4'-P energy: -17.032 tors. eta vs tors. theta energy: -13.544 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 60 Temperature: 1.250000 Total energy: -272.234776 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -272.234776 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -272.234776 (E_RNA) where: Base-Base interactions energy: -160.906 where: short stacking energy: -64.304 Base-Backbone interact. energy: -2.150 local terms energy: -109.178735 where: bonds (distance) C4'-P energy: -23.365 bonds (distance) P-C4' energy: -24.882 flat angles C4'-P-C4' energy: -29.874 flat angles P-C4'-P energy: -21.266 tors. eta vs tors. theta energy: -9.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 60 Temperature: 1.300000 Total energy: -229.078169 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.078169 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.078169 (E_RNA) where: Base-Base interactions energy: -135.041 where: short stacking energy: -70.373 Base-Backbone interact. energy: -1.189 local terms energy: -92.848788 where: bonds (distance) C4'-P energy: -19.345 bonds (distance) P-C4' energy: -22.344 flat angles C4'-P-C4' energy: -23.171 flat angles P-C4'-P energy: -16.240 tors. eta vs tors. theta energy: -11.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 60 Temperature: 1.350000 Total energy: -251.764866 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -251.764866 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -251.764866 (E_RNA) where: Base-Base interactions energy: -157.560 where: short stacking energy: -75.050 Base-Backbone interact. energy: -1.595 local terms energy: -92.610119 where: bonds (distance) C4'-P energy: -16.175 bonds (distance) P-C4' energy: -26.114 flat angles C4'-P-C4' energy: -19.306 flat angles P-C4'-P energy: -17.174 tors. eta vs tors. theta energy: -13.842 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 61 Temperature: 0.900000 Total energy: -481.472495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -481.472495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -481.472495 (E_RNA) where: Base-Base interactions energy: -332.183 where: short stacking energy: -155.340 Base-Backbone interact. energy: -1.180 local terms energy: -148.109097 where: bonds (distance) C4'-P energy: -26.703 bonds (distance) P-C4' energy: -27.498 flat angles C4'-P-C4' energy: -31.340 flat angles P-C4'-P energy: -20.343 tors. eta vs tors. theta energy: -42.224 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 61 Temperature: 0.950000 Total energy: -461.024512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.024512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.024512 (E_RNA) where: Base-Base interactions energy: -312.945 where: short stacking energy: -130.529 Base-Backbone interact. energy: -1.171 local terms energy: -146.908315 where: bonds (distance) C4'-P energy: -29.434 bonds (distance) P-C4' energy: -26.312 flat angles C4'-P-C4' energy: -26.796 flat angles P-C4'-P energy: -21.854 tors. eta vs tors. theta energy: -42.511 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 61 Temperature: 1.000000 Total energy: -452.600936 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.600936 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.600936 (E_RNA) where: Base-Base interactions energy: -324.645 where: short stacking energy: -127.428 Base-Backbone interact. energy: 0.912 local terms energy: -128.867678 where: bonds (distance) C4'-P energy: -23.634 bonds (distance) P-C4' energy: -25.107 flat angles C4'-P-C4' energy: -26.045 flat angles P-C4'-P energy: -18.149 tors. eta vs tors. theta energy: -35.933 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 61 Temperature: 1.050000 Total energy: -440.303005 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.303005 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.303005 (E_RNA) where: Base-Base interactions energy: -297.684 where: short stacking energy: -127.448 Base-Backbone interact. energy: -0.996 local terms energy: -141.622309 where: bonds (distance) C4'-P energy: -24.707 bonds (distance) P-C4' energy: -30.429 flat angles C4'-P-C4' energy: -26.111 flat angles P-C4'-P energy: -21.066 tors. eta vs tors. theta energy: -39.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 61 Temperature: 1.100000 Total energy: -402.705162 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.705162 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.705162 (E_RNA) where: Base-Base interactions energy: -277.151 where: short stacking energy: -128.971 Base-Backbone interact. energy: -1.208 local terms energy: -124.346545 where: bonds (distance) C4'-P energy: -24.487 bonds (distance) P-C4' energy: -19.766 flat angles C4'-P-C4' energy: -29.347 flat angles P-C4'-P energy: -16.366 tors. eta vs tors. theta energy: -34.380 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 61 Temperature: 1.150000 Total energy: -366.834304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.834304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.834304 (E_RNA) where: Base-Base interactions energy: -241.224 where: short stacking energy: -117.405 Base-Backbone interact. energy: -1.836 local terms energy: -123.773908 where: bonds (distance) C4'-P energy: -23.394 bonds (distance) P-C4' energy: -24.749 flat angles C4'-P-C4' energy: -27.557 flat angles P-C4'-P energy: -18.440 tors. eta vs tors. theta energy: -29.634 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 61 Temperature: 1.200000 Total energy: -241.429431 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.429431 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.429431 (E_RNA) where: Base-Base interactions energy: -131.831 where: short stacking energy: -75.628 Base-Backbone interact. energy: 0.278 local terms energy: -109.875885 where: bonds (distance) C4'-P energy: -24.670 bonds (distance) P-C4' energy: -31.786 flat angles C4'-P-C4' energy: -22.296 flat angles P-C4'-P energy: -15.582 tors. eta vs tors. theta energy: -15.542 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 61 Temperature: 1.250000 Total energy: -234.322063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.322063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.322063 (E_RNA) where: Base-Base interactions energy: -142.219 where: short stacking energy: -76.519 Base-Backbone interact. energy: -0.513 local terms energy: -91.590812 where: bonds (distance) C4'-P energy: -24.683 bonds (distance) P-C4' energy: -20.311 flat angles C4'-P-C4' energy: -15.521 flat angles P-C4'-P energy: -17.999 tors. eta vs tors. theta energy: -13.077 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 61 Temperature: 1.300000 Total energy: -276.502062 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -276.502062 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -276.502062 (E_RNA) where: Base-Base interactions energy: -181.334 where: short stacking energy: -91.747 Base-Backbone interact. energy: -0.424 local terms energy: -94.743890 where: bonds (distance) C4'-P energy: -19.434 bonds (distance) P-C4' energy: -15.337 flat angles C4'-P-C4' energy: -27.224 flat angles P-C4'-P energy: -11.584 tors. eta vs tors. theta energy: -21.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 61 Temperature: 1.350000 Total energy: -228.881777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.881777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.881777 (E_RNA) where: Base-Base interactions energy: -138.208 where: short stacking energy: -80.969 Base-Backbone interact. energy: 1.793 local terms energy: -92.466804 where: bonds (distance) C4'-P energy: -14.298 bonds (distance) P-C4' energy: -25.160 flat angles C4'-P-C4' energy: -23.695 flat angles P-C4'-P energy: -17.410 tors. eta vs tors. theta energy: -11.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 62 Temperature: 0.900000 Total energy: -466.162352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.162352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.162352 (E_RNA) where: Base-Base interactions energy: -330.042 where: short stacking energy: -147.146 Base-Backbone interact. energy: -0.117 local terms energy: -136.003824 where: bonds (distance) C4'-P energy: -22.056 bonds (distance) P-C4' energy: -26.865 flat angles C4'-P-C4' energy: -25.127 flat angles P-C4'-P energy: -20.715 tors. eta vs tors. theta energy: -41.241 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 62 Temperature: 0.950000 Total energy: -460.481027 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.481027 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.481027 (E_RNA) where: Base-Base interactions energy: -317.303 where: short stacking energy: -148.336 Base-Backbone interact. energy: -0.012 local terms energy: -143.165240 where: bonds (distance) C4'-P energy: -25.316 bonds (distance) P-C4' energy: -26.398 flat angles C4'-P-C4' energy: -28.944 flat angles P-C4'-P energy: -17.878 tors. eta vs tors. theta energy: -44.629 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 62 Temperature: 1.000000 Total energy: -456.892256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.892256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.892256 (E_RNA) where: Base-Base interactions energy: -319.013 where: short stacking energy: -133.623 Base-Backbone interact. energy: -0.450 local terms energy: -137.428660 where: bonds (distance) C4'-P energy: -27.627 bonds (distance) P-C4' energy: -25.818 flat angles C4'-P-C4' energy: -30.529 flat angles P-C4'-P energy: -17.967 tors. eta vs tors. theta energy: -35.488 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 62 Temperature: 1.050000 Total energy: -441.197400 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.197400 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.197400 (E_RNA) where: Base-Base interactions energy: -299.183 where: short stacking energy: -139.763 Base-Backbone interact. energy: -0.531 local terms energy: -141.482874 where: bonds (distance) C4'-P energy: -28.308 bonds (distance) P-C4' energy: -22.243 flat angles C4'-P-C4' energy: -27.328 flat angles P-C4'-P energy: -22.367 tors. eta vs tors. theta energy: -41.237 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 62 Temperature: 1.100000 Total energy: -403.482135 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.482135 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.482135 (E_RNA) where: Base-Base interactions energy: -281.752 where: short stacking energy: -125.663 Base-Backbone interact. energy: -1.100 local terms energy: -120.629540 where: bonds (distance) C4'-P energy: -26.371 bonds (distance) P-C4' energy: -18.260 flat angles C4'-P-C4' energy: -27.146 flat angles P-C4'-P energy: -18.771 tors. eta vs tors. theta energy: -30.081 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 62 Temperature: 1.150000 Total energy: -371.139626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.139626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.139626 (E_RNA) where: Base-Base interactions energy: -253.917 where: short stacking energy: -113.882 Base-Backbone interact. energy: -0.247 local terms energy: -116.975732 where: bonds (distance) C4'-P energy: -20.782 bonds (distance) P-C4' energy: -25.331 flat angles C4'-P-C4' energy: -21.832 flat angles P-C4'-P energy: -22.298 tors. eta vs tors. theta energy: -26.733 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 62 Temperature: 1.200000 Total energy: -245.631046 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.631046 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.631046 (E_RNA) where: Base-Base interactions energy: -142.198 where: short stacking energy: -73.194 Base-Backbone interact. energy: -0.169 local terms energy: -103.263700 where: bonds (distance) C4'-P energy: -21.959 bonds (distance) P-C4' energy: -24.915 flat angles C4'-P-C4' energy: -20.804 flat angles P-C4'-P energy: -19.229 tors. eta vs tors. theta energy: -16.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 62 Temperature: 1.250000 Total energy: -237.881350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.881350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.881350 (E_RNA) where: Base-Base interactions energy: -131.259 where: short stacking energy: -75.252 Base-Backbone interact. energy: -2.073 local terms energy: -104.549235 where: bonds (distance) C4'-P energy: -25.911 bonds (distance) P-C4' energy: -21.619 flat angles C4'-P-C4' energy: -19.348 flat angles P-C4'-P energy: -20.950 tors. eta vs tors. theta energy: -16.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 62 Temperature: 1.300000 Total energy: -273.445820 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -273.445820 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -273.445820 (E_RNA) where: Base-Base interactions energy: -165.573 where: short stacking energy: -74.610 Base-Backbone interact. energy: -0.757 local terms energy: -107.115549 where: bonds (distance) C4'-P energy: -23.943 bonds (distance) P-C4' energy: -23.838 flat angles C4'-P-C4' energy: -25.581 flat angles P-C4'-P energy: -18.300 tors. eta vs tors. theta energy: -15.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 62 Temperature: 1.350000 Total energy: -229.337287 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.337287 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.337287 (E_RNA) where: Base-Base interactions energy: -138.152 where: short stacking energy: -72.594 Base-Backbone interact. energy: -0.448 local terms energy: -90.737075 where: bonds (distance) C4'-P energy: -25.270 bonds (distance) P-C4' energy: -22.883 flat angles C4'-P-C4' energy: -19.325 flat angles P-C4'-P energy: -13.713 tors. eta vs tors. theta energy: -9.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 63 Temperature: 0.900000 Total energy: -466.999456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.999456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.999456 (E_RNA) where: Base-Base interactions energy: -322.958 where: short stacking energy: -148.735 Base-Backbone interact. energy: -0.246 local terms energy: -143.795407 where: bonds (distance) C4'-P energy: -23.924 bonds (distance) P-C4' energy: -25.417 flat angles C4'-P-C4' energy: -28.712 flat angles P-C4'-P energy: -23.090 tors. eta vs tors. theta energy: -42.652 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 63 Temperature: 0.950000 Total energy: -458.537375 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.537375 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.537375 (E_RNA) where: Base-Base interactions energy: -318.874 where: short stacking energy: -148.840 Base-Backbone interact. energy: -0.358 local terms energy: -139.305644 where: bonds (distance) C4'-P energy: -23.596 bonds (distance) P-C4' energy: -26.036 flat angles C4'-P-C4' energy: -30.577 flat angles P-C4'-P energy: -15.748 tors. eta vs tors. theta energy: -43.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 63 Temperature: 1.000000 Total energy: -467.679352 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.679352 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.679352 (E_RNA) where: Base-Base interactions energy: -322.143 where: short stacking energy: -130.013 Base-Backbone interact. energy: -0.426 local terms energy: -145.110010 where: bonds (distance) C4'-P energy: -24.148 bonds (distance) P-C4' energy: -28.142 flat angles C4'-P-C4' energy: -31.005 flat angles P-C4'-P energy: -23.900 tors. eta vs tors. theta energy: -37.914 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 63 Temperature: 1.050000 Total energy: -438.219657 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.219657 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.219657 (E_RNA) where: Base-Base interactions energy: -303.108 where: short stacking energy: -142.489 Base-Backbone interact. energy: -1.239 local terms energy: -133.872076 where: bonds (distance) C4'-P energy: -23.849 bonds (distance) P-C4' energy: -21.465 flat angles C4'-P-C4' energy: -28.152 flat angles P-C4'-P energy: -19.857 tors. eta vs tors. theta energy: -40.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 63 Temperature: 1.100000 Total energy: -403.566367 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.566367 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.566367 (E_RNA) where: Base-Base interactions energy: -275.900 where: short stacking energy: -116.099 Base-Backbone interact. energy: -0.959 local terms energy: -126.706794 where: bonds (distance) C4'-P energy: -20.440 bonds (distance) P-C4' energy: -25.928 flat angles C4'-P-C4' energy: -31.036 flat angles P-C4'-P energy: -17.405 tors. eta vs tors. theta energy: -31.898 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 63 Temperature: 1.150000 Total energy: -364.633166 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.633166 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.633166 (E_RNA) where: Base-Base interactions energy: -231.911 where: short stacking energy: -110.863 Base-Backbone interact. energy: -1.524 local terms energy: -131.198938 where: bonds (distance) C4'-P energy: -26.781 bonds (distance) P-C4' energy: -28.375 flat angles C4'-P-C4' energy: -31.540 flat angles P-C4'-P energy: -16.484 tors. eta vs tors. theta energy: -28.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 6 ===================================== Write number: 63 Temperature: 1.200000 Total energy: -285.997781 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -285.997781 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -285.997781 (E_RNA) where: Base-Base interactions energy: -171.300 where: short stacking energy: -102.511 Base-Backbone interact. energy: -0.233 local terms energy: -114.465554 where: bonds (distance) C4'-P energy: -24.102 bonds (distance) P-C4' energy: -26.642 flat angles C4'-P-C4' energy: -22.995 flat angles P-C4'-P energy: -10.818 tors. eta vs tors. theta energy: -29.907 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 63 Temperature: 1.250000 Total energy: -283.722736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -283.722736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -283.722736 (E_RNA) where: Base-Base interactions energy: -190.959 where: short stacking energy: -90.032 Base-Backbone interact. energy: 0.260 local terms energy: -93.023751 where: bonds (distance) C4'-P energy: -19.837 bonds (distance) P-C4' energy: -21.651 flat angles C4'-P-C4' energy: -19.464 flat angles P-C4'-P energy: -14.319 tors. eta vs tors. theta energy: -17.752 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 63 Temperature: 1.300000 Total energy: -237.130105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.130105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.130105 (E_RNA) where: Base-Base interactions energy: -136.767 where: short stacking energy: -77.665 Base-Backbone interact. energy: -0.474 local terms energy: -99.888581 where: bonds (distance) C4'-P energy: -22.777 bonds (distance) P-C4' energy: -28.070 flat angles C4'-P-C4' energy: -18.015 flat angles P-C4'-P energy: -13.676 tors. eta vs tors. theta energy: -17.351 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 63 Temperature: 1.350000 Total energy: -215.891803 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.891803 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.891803 (E_RNA) where: Base-Base interactions energy: -133.011 where: short stacking energy: -78.156 Base-Backbone interact. energy: -1.297 local terms energy: -81.583360 where: bonds (distance) C4'-P energy: -17.438 bonds (distance) P-C4' energy: -19.098 flat angles C4'-P-C4' energy: -22.263 flat angles P-C4'-P energy: -11.259 tors. eta vs tors. theta energy: -11.526 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 64 Temperature: 0.900000 Total energy: -461.010334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.010334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.010334 (E_RNA) where: Base-Base interactions energy: -320.416 where: short stacking energy: -133.423 Base-Backbone interact. energy: -1.167 local terms energy: -139.426592 where: bonds (distance) C4'-P energy: -26.712 bonds (distance) P-C4' energy: -28.125 flat angles C4'-P-C4' energy: -27.292 flat angles P-C4'-P energy: -19.774 tors. eta vs tors. theta energy: -37.524 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 64 Temperature: 0.950000 Total energy: -462.248886 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.248886 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.248886 (E_RNA) where: Base-Base interactions energy: -319.381 where: short stacking energy: -140.362 Base-Backbone interact. energy: 0.006 local terms energy: -142.874041 where: bonds (distance) C4'-P energy: -22.027 bonds (distance) P-C4' energy: -31.319 flat angles C4'-P-C4' energy: -26.723 flat angles P-C4'-P energy: -21.821 tors. eta vs tors. theta energy: -40.984 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 64 Temperature: 1.000000 Total energy: -459.137212 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.137212 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.137212 (E_RNA) where: Base-Base interactions energy: -323.415 where: short stacking energy: -135.086 Base-Backbone interact. energy: 0.496 local terms energy: -136.217724 where: bonds (distance) C4'-P energy: -25.919 bonds (distance) P-C4' energy: -28.772 flat angles C4'-P-C4' energy: -26.410 flat angles P-C4'-P energy: -17.838 tors. eta vs tors. theta energy: -37.279 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 64 Temperature: 1.050000 Total energy: -438.181945 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.181945 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.181945 (E_RNA) where: Base-Base interactions energy: -297.303 where: short stacking energy: -135.913 Base-Backbone interact. energy: -0.442 local terms energy: -140.436816 where: bonds (distance) C4'-P energy: -27.003 bonds (distance) P-C4' energy: -31.582 flat angles C4'-P-C4' energy: -29.165 flat angles P-C4'-P energy: -17.858 tors. eta vs tors. theta energy: -34.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 64 Temperature: 1.100000 Total energy: -406.719292 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.719292 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.719292 (E_RNA) where: Base-Base interactions energy: -277.575 where: short stacking energy: -126.707 Base-Backbone interact. energy: -0.427 local terms energy: -128.717055 where: bonds (distance) C4'-P energy: -28.004 bonds (distance) P-C4' energy: -23.221 flat angles C4'-P-C4' energy: -26.819 flat angles P-C4'-P energy: -14.363 tors. eta vs tors. theta energy: -36.310 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 64 Temperature: 1.150000 Total energy: -381.364334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.364334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.364334 (E_RNA) where: Base-Base interactions energy: -271.884 where: short stacking energy: -120.165 Base-Backbone interact. energy: 1.055 local terms energy: -110.535527 where: bonds (distance) C4'-P energy: -15.373 bonds (distance) P-C4' energy: -21.795 flat angles C4'-P-C4' energy: -25.432 flat angles P-C4'-P energy: -19.608 tors. eta vs tors. theta energy: -28.327 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 64 Temperature: 1.200000 Total energy: -274.102621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -274.102621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -274.102621 (E_RNA) where: Base-Base interactions energy: -169.081 where: short stacking energy: -71.407 Base-Backbone interact. energy: -0.436 local terms energy: -104.585546 where: bonds (distance) C4'-P energy: -26.964 bonds (distance) P-C4' energy: -21.940 flat angles C4'-P-C4' energy: -25.617 flat angles P-C4'-P energy: -17.367 tors. eta vs tors. theta energy: -12.697 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 64 Temperature: 1.250000 Total energy: -253.529761 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -253.529761 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -253.529761 (E_RNA) where: Base-Base interactions energy: -147.473 where: short stacking energy: -96.559 Base-Backbone interact. energy: -1.162 local terms energy: -104.894141 where: bonds (distance) C4'-P energy: -17.390 bonds (distance) P-C4' energy: -22.340 flat angles C4'-P-C4' energy: -22.455 flat angles P-C4'-P energy: -16.176 tors. eta vs tors. theta energy: -26.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 64 Temperature: 1.300000 Total energy: -241.156823 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.156823 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.156823 (E_RNA) where: Base-Base interactions energy: -142.019 where: short stacking energy: -63.196 Base-Backbone interact. energy: 3.019 local terms energy: -102.156848 where: bonds (distance) C4'-P energy: -18.882 bonds (distance) P-C4' energy: -26.067 flat angles C4'-P-C4' energy: -27.039 flat angles P-C4'-P energy: -16.647 tors. eta vs tors. theta energy: -13.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 64 Temperature: 1.350000 Total energy: -208.389696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.389696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.389696 (E_RNA) where: Base-Base interactions energy: -121.160 where: short stacking energy: -71.159 Base-Backbone interact. energy: -0.119 local terms energy: -87.111010 where: bonds (distance) C4'-P energy: -11.640 bonds (distance) P-C4' energy: -26.352 flat angles C4'-P-C4' energy: -23.395 flat angles P-C4'-P energy: -15.393 tors. eta vs tors. theta energy: -10.331 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 65 Temperature: 0.900000 Total energy: -455.149401 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.149401 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.149401 (E_RNA) where: Base-Base interactions energy: -317.238 where: short stacking energy: -153.934 Base-Backbone interact. energy: -0.637 local terms energy: -137.273559 where: bonds (distance) C4'-P energy: -21.051 bonds (distance) P-C4' energy: -21.141 flat angles C4'-P-C4' energy: -32.382 flat angles P-C4'-P energy: -21.560 tors. eta vs tors. theta energy: -41.139 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 65 Temperature: 0.950000 Total energy: -457.067740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.067740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.067740 (E_RNA) where: Base-Base interactions energy: -333.595 where: short stacking energy: -138.654 Base-Backbone interact. energy: -1.423 local terms energy: -122.049428 where: bonds (distance) C4'-P energy: -23.624 bonds (distance) P-C4' energy: -22.732 flat angles C4'-P-C4' energy: -16.586 flat angles P-C4'-P energy: -20.712 tors. eta vs tors. theta energy: -38.397 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 65 Temperature: 1.000000 Total energy: -466.656790 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.656790 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.656790 (E_RNA) where: Base-Base interactions energy: -322.232 where: short stacking energy: -152.251 Base-Backbone interact. energy: -0.635 local terms energy: -143.789765 where: bonds (distance) C4'-P energy: -27.733 bonds (distance) P-C4' energy: -24.611 flat angles C4'-P-C4' energy: -28.736 flat angles P-C4'-P energy: -22.450 tors. eta vs tors. theta energy: -40.260 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 65 Temperature: 1.050000 Total energy: -409.342835 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.342835 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.342835 (E_RNA) where: Base-Base interactions energy: -280.171 where: short stacking energy: -124.709 Base-Backbone interact. energy: -0.513 local terms energy: -128.658670 where: bonds (distance) C4'-P energy: -28.171 bonds (distance) P-C4' energy: -24.369 flat angles C4'-P-C4' energy: -25.951 flat angles P-C4'-P energy: -17.478 tors. eta vs tors. theta energy: -32.688 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 65 Temperature: 1.100000 Total energy: -404.125386 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.125386 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.125386 (E_RNA) where: Base-Base interactions energy: -268.232 where: short stacking energy: -121.347 Base-Backbone interact. energy: -0.792 local terms energy: -135.101188 where: bonds (distance) C4'-P energy: -27.898 bonds (distance) P-C4' energy: -23.836 flat angles C4'-P-C4' energy: -27.200 flat angles P-C4'-P energy: -19.649 tors. eta vs tors. theta energy: -36.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 65 Temperature: 1.150000 Total energy: -346.785221 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.785221 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.785221 (E_RNA) where: Base-Base interactions energy: -234.921 where: short stacking energy: -113.423 Base-Backbone interact. energy: -0.688 local terms energy: -111.175496 where: bonds (distance) C4'-P energy: -21.958 bonds (distance) P-C4' energy: -21.629 flat angles C4'-P-C4' energy: -26.411 flat angles P-C4'-P energy: -15.904 tors. eta vs tors. theta energy: -25.274 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 65 Temperature: 1.200000 Total energy: -303.771440 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.771440 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.771440 (E_RNA) where: Base-Base interactions energy: -202.073 where: short stacking energy: -99.468 Base-Backbone interact. energy: -0.251 local terms energy: -101.446706 where: bonds (distance) C4'-P energy: -22.649 bonds (distance) P-C4' energy: -24.423 flat angles C4'-P-C4' energy: -20.133 flat angles P-C4'-P energy: -11.193 tors. eta vs tors. theta energy: -23.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 65 Temperature: 1.250000 Total energy: -227.260042 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.260042 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.260042 (E_RNA) where: Base-Base interactions energy: -140.034 where: short stacking energy: -84.761 Base-Backbone interact. energy: -0.957 local terms energy: -86.268919 where: bonds (distance) C4'-P energy: -20.766 bonds (distance) P-C4' energy: -17.565 flat angles C4'-P-C4' energy: -21.173 flat angles P-C4'-P energy: -10.470 tors. eta vs tors. theta energy: -16.296 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 65 Temperature: 1.300000 Total energy: -228.875240 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.875240 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.875240 (E_RNA) where: Base-Base interactions energy: -128.414 where: short stacking energy: -73.685 Base-Backbone interact. energy: -0.574 local terms energy: -99.887142 where: bonds (distance) C4'-P energy: -23.385 bonds (distance) P-C4' energy: -19.031 flat angles C4'-P-C4' energy: -21.464 flat angles P-C4'-P energy: -19.311 tors. eta vs tors. theta energy: -16.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 65 Temperature: 1.350000 Total energy: -205.546399 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -205.546399 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -205.546399 (E_RNA) where: Base-Base interactions energy: -116.853 where: short stacking energy: -63.657 Base-Backbone interact. energy: -0.268 local terms energy: -88.425558 where: bonds (distance) C4'-P energy: -18.534 bonds (distance) P-C4' energy: -23.393 flat angles C4'-P-C4' energy: -24.027 flat angles P-C4'-P energy: -12.415 tors. eta vs tors. theta energy: -10.056 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 66 Temperature: 0.900000 Total energy: -463.673566 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.673566 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.673566 (E_RNA) where: Base-Base interactions energy: -315.576 where: short stacking energy: -145.516 Base-Backbone interact. energy: -0.496 local terms energy: -147.601699 where: bonds (distance) C4'-P energy: -24.802 bonds (distance) P-C4' energy: -27.191 flat angles C4'-P-C4' energy: -32.027 flat angles P-C4'-P energy: -21.771 tors. eta vs tors. theta energy: -41.811 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 66 Temperature: 0.950000 Total energy: -464.482617 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.482617 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.482617 (E_RNA) where: Base-Base interactions energy: -331.904 where: short stacking energy: -137.129 Base-Backbone interact. energy: -2.052 local terms energy: -130.526390 where: bonds (distance) C4'-P energy: -19.838 bonds (distance) P-C4' energy: -22.168 flat angles C4'-P-C4' energy: -27.986 flat angles P-C4'-P energy: -25.172 tors. eta vs tors. theta energy: -35.362 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 66 Temperature: 1.000000 Total energy: -447.982653 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.982653 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.982653 (E_RNA) where: Base-Base interactions energy: -309.306 where: short stacking energy: -137.385 Base-Backbone interact. energy: -0.538 local terms energy: -138.138198 where: bonds (distance) C4'-P energy: -27.231 bonds (distance) P-C4' energy: -25.997 flat angles C4'-P-C4' energy: -25.110 flat angles P-C4'-P energy: -21.525 tors. eta vs tors. theta energy: -38.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 66 Temperature: 1.050000 Total energy: -406.721935 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -406.721935 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -406.721935 (E_RNA) where: Base-Base interactions energy: -282.543 where: short stacking energy: -124.983 Base-Backbone interact. energy: -1.551 local terms energy: -122.627395 where: bonds (distance) C4'-P energy: -23.007 bonds (distance) P-C4' energy: -22.801 flat angles C4'-P-C4' energy: -27.223 flat angles P-C4'-P energy: -17.579 tors. eta vs tors. theta energy: -32.018 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 66 Temperature: 1.100000 Total energy: -409.236494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -409.236494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -409.236494 (E_RNA) where: Base-Base interactions energy: -279.129 where: short stacking energy: -126.029 Base-Backbone interact. energy: -0.423 local terms energy: -129.684168 where: bonds (distance) C4'-P energy: -23.906 bonds (distance) P-C4' energy: -26.812 flat angles C4'-P-C4' energy: -23.486 flat angles P-C4'-P energy: -17.934 tors. eta vs tors. theta energy: -37.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 66 Temperature: 1.150000 Total energy: -368.379705 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -368.379705 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -368.379705 (E_RNA) where: Base-Base interactions energy: -247.642 where: short stacking energy: -115.462 Base-Backbone interact. energy: -0.157 local terms energy: -120.580940 where: bonds (distance) C4'-P energy: -28.089 bonds (distance) P-C4' energy: -29.992 flat angles C4'-P-C4' energy: -22.642 flat angles P-C4'-P energy: -12.712 tors. eta vs tors. theta energy: -27.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 66 Temperature: 1.200000 Total energy: -310.499475 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.499475 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.499475 (E_RNA) where: Base-Base interactions energy: -197.238 where: short stacking energy: -97.551 Base-Backbone interact. energy: -1.080 local terms energy: -112.181652 where: bonds (distance) C4'-P energy: -25.610 bonds (distance) P-C4' energy: -27.365 flat angles C4'-P-C4' energy: -24.670 flat angles P-C4'-P energy: -18.125 tors. eta vs tors. theta energy: -16.412 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 66 Temperature: 1.250000 Total energy: -226.552184 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -226.552184 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -226.552184 (E_RNA) where: Base-Base interactions energy: -127.897 where: short stacking energy: -73.483 Base-Backbone interact. energy: -0.584 local terms energy: -98.070729 where: bonds (distance) C4'-P energy: -22.437 bonds (distance) P-C4' energy: -25.034 flat angles C4'-P-C4' energy: -24.981 flat angles P-C4'-P energy: -15.723 tors. eta vs tors. theta energy: -9.895 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 66 Temperature: 1.300000 Total energy: -221.106569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -221.106569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -221.106569 (E_RNA) where: Base-Base interactions energy: -132.647 where: short stacking energy: -64.209 Base-Backbone interact. energy: 0.245 local terms energy: -88.704994 where: bonds (distance) C4'-P energy: -23.217 bonds (distance) P-C4' energy: -25.191 flat angles C4'-P-C4' energy: -25.412 flat angles P-C4'-P energy: -7.838 tors. eta vs tors. theta energy: -7.047 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 66 Temperature: 1.350000 Total energy: -186.233255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -186.233255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -186.233255 (E_RNA) where: Base-Base interactions energy: -103.882 where: short stacking energy: -51.359 Base-Backbone interact. energy: -0.919 local terms energy: -81.432009 where: bonds (distance) C4'-P energy: -29.524 bonds (distance) P-C4' energy: -20.660 flat angles C4'-P-C4' energy: -13.208 flat angles P-C4'-P energy: -9.074 tors. eta vs tors. theta energy: -8.966 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 67 Temperature: 0.900000 Total energy: -461.648849 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.648849 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.648849 (E_RNA) where: Base-Base interactions energy: -317.670 where: short stacking energy: -136.152 Base-Backbone interact. energy: -0.397 local terms energy: -143.581383 where: bonds (distance) C4'-P energy: -26.578 bonds (distance) P-C4' energy: -28.148 flat angles C4'-P-C4' energy: -29.308 flat angles P-C4'-P energy: -20.447 tors. eta vs tors. theta energy: -39.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 67 Temperature: 0.950000 Total energy: -452.467722 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.467722 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.467722 (E_RNA) where: Base-Base interactions energy: -316.013 where: short stacking energy: -126.022 Base-Backbone interact. energy: -1.252 local terms energy: -135.203053 where: bonds (distance) C4'-P energy: -26.551 bonds (distance) P-C4' energy: -23.108 flat angles C4'-P-C4' energy: -29.060 flat angles P-C4'-P energy: -19.837 tors. eta vs tors. theta energy: -36.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 67 Temperature: 1.000000 Total energy: -448.808882 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.808882 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.808882 (E_RNA) where: Base-Base interactions energy: -308.498 where: short stacking energy: -136.108 Base-Backbone interact. energy: -2.271 local terms energy: -138.039211 where: bonds (distance) C4'-P energy: -22.547 bonds (distance) P-C4' energy: -27.406 flat angles C4'-P-C4' energy: -25.675 flat angles P-C4'-P energy: -22.585 tors. eta vs tors. theta energy: -39.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 67 Temperature: 1.050000 Total energy: -407.307494 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.307494 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.307494 (E_RNA) where: Base-Base interactions energy: -272.488 where: short stacking energy: -118.552 Base-Backbone interact. energy: -1.312 local terms energy: -133.507878 where: bonds (distance) C4'-P energy: -24.054 bonds (distance) P-C4' energy: -26.835 flat angles C4'-P-C4' energy: -29.024 flat angles P-C4'-P energy: -17.167 tors. eta vs tors. theta energy: -36.428 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 67 Temperature: 1.100000 Total energy: -422.356602 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.356602 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.356602 (E_RNA) where: Base-Base interactions energy: -286.745 where: short stacking energy: -123.083 Base-Backbone interact. energy: -1.045 local terms energy: -134.566668 where: bonds (distance) C4'-P energy: -24.836 bonds (distance) P-C4' energy: -24.143 flat angles C4'-P-C4' energy: -28.855 flat angles P-C4'-P energy: -22.175 tors. eta vs tors. theta energy: -34.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 67 Temperature: 1.150000 Total energy: -364.451777 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.451777 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.451777 (E_RNA) where: Base-Base interactions energy: -242.074 where: short stacking energy: -113.821 Base-Backbone interact. energy: -0.437 local terms energy: -121.940639 where: bonds (distance) C4'-P energy: -26.028 bonds (distance) P-C4' energy: -30.365 flat angles C4'-P-C4' energy: -24.314 flat angles P-C4'-P energy: -16.138 tors. eta vs tors. theta energy: -25.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 67 Temperature: 1.200000 Total energy: -304.129719 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -304.129719 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -304.129719 (E_RNA) where: Base-Base interactions energy: -203.635 where: short stacking energy: -93.047 Base-Backbone interact. energy: -1.167 local terms energy: -99.327781 where: bonds (distance) C4'-P energy: -20.910 bonds (distance) P-C4' energy: -25.656 flat angles C4'-P-C4' energy: -26.573 flat angles P-C4'-P energy: -8.594 tors. eta vs tors. theta energy: -17.595 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 67 Temperature: 1.250000 Total energy: -249.602001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.602001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.602001 (E_RNA) where: Base-Base interactions energy: -166.500 where: short stacking energy: -81.016 Base-Backbone interact. energy: -0.794 local terms energy: -82.308030 where: bonds (distance) C4'-P energy: -24.268 bonds (distance) P-C4' energy: -16.100 flat angles C4'-P-C4' energy: -20.875 flat angles P-C4'-P energy: -14.353 tors. eta vs tors. theta energy: -6.711 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 67 Temperature: 1.300000 Total energy: -225.068636 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.068636 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.068636 (E_RNA) where: Base-Base interactions energy: -121.182 where: short stacking energy: -62.231 Base-Backbone interact. energy: -0.591 local terms energy: -103.295434 where: bonds (distance) C4'-P energy: -25.452 bonds (distance) P-C4' energy: -27.790 flat angles C4'-P-C4' energy: -24.739 flat angles P-C4'-P energy: -14.020 tors. eta vs tors. theta energy: -11.295 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 67 Temperature: 1.350000 Total energy: -181.067418 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -181.067418 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -181.067418 (E_RNA) where: Base-Base interactions energy: -100.361 where: short stacking energy: -63.707 Base-Backbone interact. energy: -0.424 local terms energy: -80.282425 where: bonds (distance) C4'-P energy: -23.795 bonds (distance) P-C4' energy: -9.334 flat angles C4'-P-C4' energy: -23.790 flat angles P-C4'-P energy: -18.458 tors. eta vs tors. theta energy: -4.905 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 68 Temperature: 0.900000 Total energy: -455.317730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.317730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.317730 (E_RNA) where: Base-Base interactions energy: -316.679 where: short stacking energy: -141.076 Base-Backbone interact. energy: -0.959 local terms energy: -137.679819 where: bonds (distance) C4'-P energy: -20.825 bonds (distance) P-C4' energy: -26.863 flat angles C4'-P-C4' energy: -31.573 flat angles P-C4'-P energy: -19.135 tors. eta vs tors. theta energy: -39.283 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 68 Temperature: 0.950000 Total energy: -446.868798 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.868798 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.868798 (E_RNA) where: Base-Base interactions energy: -312.259 where: short stacking energy: -128.604 Base-Backbone interact. energy: -0.508 local terms energy: -134.102156 where: bonds (distance) C4'-P energy: -19.949 bonds (distance) P-C4' energy: -24.644 flat angles C4'-P-C4' energy: -30.997 flat angles P-C4'-P energy: -22.781 tors. eta vs tors. theta energy: -35.730 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 68 Temperature: 1.000000 Total energy: -417.393033 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -417.393033 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -417.393033 (E_RNA) where: Base-Base interactions energy: -297.265 where: short stacking energy: -134.549 Base-Backbone interact. energy: -0.892 local terms energy: -119.236439 where: bonds (distance) C4'-P energy: -23.117 bonds (distance) P-C4' energy: -18.432 flat angles C4'-P-C4' energy: -29.325 flat angles P-C4'-P energy: -14.237 tors. eta vs tors. theta energy: -34.126 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 68 Temperature: 1.050000 Total energy: -435.070209 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.070209 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.070209 (E_RNA) where: Base-Base interactions energy: -300.761 where: short stacking energy: -127.565 Base-Backbone interact. energy: -0.795 local terms energy: -133.514529 where: bonds (distance) C4'-P energy: -22.959 bonds (distance) P-C4' energy: -26.737 flat angles C4'-P-C4' energy: -24.970 flat angles P-C4'-P energy: -20.159 tors. eta vs tors. theta energy: -38.690 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 4 ===================================== Write number: 68 Temperature: 1.100000 Total energy: -421.488814 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -421.488814 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -421.488814 (E_RNA) where: Base-Base interactions energy: -286.935 where: short stacking energy: -139.065 Base-Backbone interact. energy: -0.102 local terms energy: -134.452168 where: bonds (distance) C4'-P energy: -24.626 bonds (distance) P-C4' energy: -20.726 flat angles C4'-P-C4' energy: -26.652 flat angles P-C4'-P energy: -20.028 tors. eta vs tors. theta energy: -42.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 68 Temperature: 1.150000 Total energy: -359.580362 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.580362 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.580362 (E_RNA) where: Base-Base interactions energy: -247.716 where: short stacking energy: -115.183 Base-Backbone interact. energy: -0.433 local terms energy: -111.431711 where: bonds (distance) C4'-P energy: -21.539 bonds (distance) P-C4' energy: -23.494 flat angles C4'-P-C4' energy: -24.407 flat angles P-C4'-P energy: -17.337 tors. eta vs tors. theta energy: -24.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 68 Temperature: 1.200000 Total energy: -300.356874 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -300.356874 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -300.356874 (E_RNA) where: Base-Base interactions energy: -192.716 where: short stacking energy: -95.618 Base-Backbone interact. energy: -0.387 local terms energy: -107.253936 where: bonds (distance) C4'-P energy: -25.786 bonds (distance) P-C4' energy: -28.238 flat angles C4'-P-C4' energy: -21.578 flat angles P-C4'-P energy: -11.463 tors. eta vs tors. theta energy: -20.190 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 68 Temperature: 1.250000 Total energy: -268.972825 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.972825 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.972825 (E_RNA) where: Base-Base interactions energy: -151.257 where: short stacking energy: -77.482 Base-Backbone interact. energy: -1.198 local terms energy: -116.517374 where: bonds (distance) C4'-P energy: -28.766 bonds (distance) P-C4' energy: -25.335 flat angles C4'-P-C4' energy: -28.993 flat angles P-C4'-P energy: -19.029 tors. eta vs tors. theta energy: -14.394 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 68 Temperature: 1.300000 Total energy: -220.968557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -220.968557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -220.968557 (E_RNA) where: Base-Base interactions energy: -120.212 where: short stacking energy: -59.065 Base-Backbone interact. energy: -0.039 local terms energy: -100.717158 where: bonds (distance) C4'-P energy: -31.232 bonds (distance) P-C4' energy: -23.238 flat angles C4'-P-C4' energy: -18.425 flat angles P-C4'-P energy: -14.098 tors. eta vs tors. theta energy: -13.724 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 68 Temperature: 1.350000 Total energy: -129.740783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -129.740783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -129.740783 (E_RNA) where: Base-Base interactions energy: -54.137 where: short stacking energy: -45.147 Base-Backbone interact. energy: -0.603 local terms energy: -75.000876 where: bonds (distance) C4'-P energy: -25.158 bonds (distance) P-C4' energy: -22.800 flat angles C4'-P-C4' energy: -19.719 flat angles P-C4'-P energy: -6.292 tors. eta vs tors. theta energy: -1.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 69 Temperature: 0.900000 Total energy: -453.813182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.813182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.813182 (E_RNA) where: Base-Base interactions energy: -307.325 where: short stacking energy: -146.594 Base-Backbone interact. energy: -0.789 local terms energy: -145.698854 where: bonds (distance) C4'-P energy: -27.268 bonds (distance) P-C4' energy: -26.099 flat angles C4'-P-C4' energy: -33.293 flat angles P-C4'-P energy: -18.629 tors. eta vs tors. theta energy: -40.410 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 69 Temperature: 0.950000 Total energy: -432.835201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.835201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.835201 (E_RNA) where: Base-Base interactions energy: -296.775 where: short stacking energy: -146.130 Base-Backbone interact. energy: -0.032 local terms energy: -136.027790 where: bonds (distance) C4'-P energy: -22.673 bonds (distance) P-C4' energy: -28.746 flat angles C4'-P-C4' energy: -29.334 flat angles P-C4'-P energy: -19.602 tors. eta vs tors. theta energy: -35.673 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 69 Temperature: 1.000000 Total energy: -444.121680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.121680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.121680 (E_RNA) where: Base-Base interactions energy: -311.325 where: short stacking energy: -123.913 Base-Backbone interact. energy: -0.760 local terms energy: -132.035982 where: bonds (distance) C4'-P energy: -23.120 bonds (distance) P-C4' energy: -27.861 flat angles C4'-P-C4' energy: -26.982 flat angles P-C4'-P energy: -19.559 tors. eta vs tors. theta energy: -34.513 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 69 Temperature: 1.050000 Total energy: -444.356618 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.356618 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.356618 (E_RNA) where: Base-Base interactions energy: -302.259 where: short stacking energy: -142.800 Base-Backbone interact. energy: -0.999 local terms energy: -141.097987 where: bonds (distance) C4'-P energy: -29.509 bonds (distance) P-C4' energy: -21.833 flat angles C4'-P-C4' energy: -29.559 flat angles P-C4'-P energy: -19.016 tors. eta vs tors. theta energy: -41.181 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 69 Temperature: 1.100000 Total energy: -433.361981 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.361981 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.361981 (E_RNA) where: Base-Base interactions energy: -302.278 where: short stacking energy: -132.655 Base-Backbone interact. energy: -0.855 local terms energy: -130.228667 where: bonds (distance) C4'-P energy: -17.583 bonds (distance) P-C4' energy: -24.542 flat angles C4'-P-C4' energy: -25.479 flat angles P-C4'-P energy: -18.564 tors. eta vs tors. theta energy: -44.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 69 Temperature: 1.150000 Total energy: -310.567297 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -310.567297 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -310.567297 (E_RNA) where: Base-Base interactions energy: -208.220 where: short stacking energy: -99.130 Base-Backbone interact. energy: -0.948 local terms energy: -101.398878 where: bonds (distance) C4'-P energy: -23.187 bonds (distance) P-C4' energy: -15.516 flat angles C4'-P-C4' energy: -20.999 flat angles P-C4'-P energy: -18.002 tors. eta vs tors. theta energy: -23.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 69 Temperature: 1.200000 Total energy: -362.626966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.626966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.626966 (E_RNA) where: Base-Base interactions energy: -241.501 where: short stacking energy: -106.547 Base-Backbone interact. energy: -0.218 local terms energy: -120.908831 where: bonds (distance) C4'-P energy: -26.193 bonds (distance) P-C4' energy: -26.204 flat angles C4'-P-C4' energy: -23.694 flat angles P-C4'-P energy: -14.832 tors. eta vs tors. theta energy: -29.985 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 69 Temperature: 1.250000 Total energy: -262.398288 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.398288 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.398288 (E_RNA) where: Base-Base interactions energy: -156.506 where: short stacking energy: -73.559 Base-Backbone interact. energy: -0.292 local terms energy: -105.600766 where: bonds (distance) C4'-P energy: -28.035 bonds (distance) P-C4' energy: -26.539 flat angles C4'-P-C4' energy: -22.668 flat angles P-C4'-P energy: -18.258 tors. eta vs tors. theta energy: -10.100 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 69 Temperature: 1.300000 Total energy: -227.758594 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -227.758594 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -227.758594 (E_RNA) where: Base-Base interactions energy: -134.215 where: short stacking energy: -77.804 Base-Backbone interact. energy: 0.323 local terms energy: -93.866758 where: bonds (distance) C4'-P energy: -28.246 bonds (distance) P-C4' energy: -20.408 flat angles C4'-P-C4' energy: -19.629 flat angles P-C4'-P energy: -15.750 tors. eta vs tors. theta energy: -9.834 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 69 Temperature: 1.350000 Total energy: -142.291904 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -142.291904 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -142.291904 (E_RNA) where: Base-Base interactions energy: -56.466 where: short stacking energy: -45.150 Base-Backbone interact. energy: -0.317 local terms energy: -85.509433 where: bonds (distance) C4'-P energy: -21.077 bonds (distance) P-C4' energy: -21.483 flat angles C4'-P-C4' energy: -23.890 flat angles P-C4'-P energy: -11.271 tors. eta vs tors. theta energy: -7.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 70 Temperature: 0.900000 Total energy: -456.054232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.054232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.054232 (E_RNA) where: Base-Base interactions energy: -313.955 where: short stacking energy: -147.241 Base-Backbone interact. energy: -1.025 local terms energy: -141.073763 where: bonds (distance) C4'-P energy: -25.871 bonds (distance) P-C4' energy: -22.931 flat angles C4'-P-C4' energy: -25.559 flat angles P-C4'-P energy: -25.765 tors. eta vs tors. theta energy: -40.949 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 3 ===================================== Write number: 70 Temperature: 0.950000 Total energy: -433.743982 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.743982 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.743982 (E_RNA) where: Base-Base interactions energy: -293.146 where: short stacking energy: -137.746 Base-Backbone interact. energy: -0.935 local terms energy: -139.663281 where: bonds (distance) C4'-P energy: -28.304 bonds (distance) P-C4' energy: -26.135 flat angles C4'-P-C4' energy: -27.892 flat angles P-C4'-P energy: -23.036 tors. eta vs tors. theta energy: -34.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 70 Temperature: 1.000000 Total energy: -442.050015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.050015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.050015 (E_RNA) where: Base-Base interactions energy: -301.636 where: short stacking energy: -129.720 Base-Backbone interact. energy: -0.015 local terms energy: -140.398970 where: bonds (distance) C4'-P energy: -27.925 bonds (distance) P-C4' energy: -27.252 flat angles C4'-P-C4' energy: -27.634 flat angles P-C4'-P energy: -17.086 tors. eta vs tors. theta energy: -40.503 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 70 Temperature: 1.050000 Total energy: -442.761299 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.761299 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.761299 (E_RNA) where: Base-Base interactions energy: -313.961 where: short stacking energy: -124.276 Base-Backbone interact. energy: 0.094 local terms energy: -128.894722 where: bonds (distance) C4'-P energy: -23.390 bonds (distance) P-C4' energy: -24.144 flat angles C4'-P-C4' energy: -27.100 flat angles P-C4'-P energy: -21.384 tors. eta vs tors. theta energy: -32.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 70 Temperature: 1.100000 Total energy: -437.529961 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.529961 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.529961 (E_RNA) where: Base-Base interactions energy: -298.933 where: short stacking energy: -127.233 Base-Backbone interact. energy: -2.327 local terms energy: -136.270077 where: bonds (distance) C4'-P energy: -25.859 bonds (distance) P-C4' energy: -24.248 flat angles C4'-P-C4' energy: -28.178 flat angles P-C4'-P energy: -21.850 tors. eta vs tors. theta energy: -36.136 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 70 Temperature: 1.150000 Total energy: -293.571502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.571502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.571502 (E_RNA) where: Base-Base interactions energy: -182.126 where: short stacking energy: -90.405 Base-Backbone interact. energy: 0.057 local terms energy: -111.503332 where: bonds (distance) C4'-P energy: -22.668 bonds (distance) P-C4' energy: -29.665 flat angles C4'-P-C4' energy: -24.743 flat angles P-C4'-P energy: -16.957 tors. eta vs tors. theta energy: -17.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 70 Temperature: 1.200000 Total energy: -332.908876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.908876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.908876 (E_RNA) where: Base-Base interactions energy: -226.218 where: short stacking energy: -103.279 Base-Backbone interact. energy: -0.210 local terms energy: -106.480697 where: bonds (distance) C4'-P energy: -25.543 bonds (distance) P-C4' energy: -21.706 flat angles C4'-P-C4' energy: -27.357 flat angles P-C4'-P energy: -12.818 tors. eta vs tors. theta energy: -19.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 70 Temperature: 1.250000 Total energy: -239.009630 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -239.009630 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -239.009630 (E_RNA) where: Base-Base interactions energy: -135.923 where: short stacking energy: -69.527 Base-Backbone interact. energy: 0.075 local terms energy: -103.161000 where: bonds (distance) C4'-P energy: -25.522 bonds (distance) P-C4' energy: -25.420 flat angles C4'-P-C4' energy: -23.914 flat angles P-C4'-P energy: -17.139 tors. eta vs tors. theta energy: -11.166 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 70 Temperature: 1.300000 Total energy: -245.854753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.854753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.854753 (E_RNA) where: Base-Base interactions energy: -158.001 where: short stacking energy: -74.352 Base-Backbone interact. energy: -0.341 local terms energy: -87.512876 where: bonds (distance) C4'-P energy: -22.152 bonds (distance) P-C4' energy: -27.868 flat angles C4'-P-C4' energy: -20.417 flat angles P-C4'-P energy: -4.811 tors. eta vs tors. theta energy: -12.266 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 70 Temperature: 1.350000 Total energy: -132.751153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.751153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.751153 (E_RNA) where: Base-Base interactions energy: -53.485 where: short stacking energy: -46.263 Base-Backbone interact. energy: 2.693 local terms energy: -81.959266 where: bonds (distance) C4'-P energy: -18.603 bonds (distance) P-C4' energy: -22.988 flat angles C4'-P-C4' energy: -18.307 flat angles P-C4'-P energy: -19.026 tors. eta vs tors. theta energy: -3.034 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 71 Temperature: 0.900000 Total energy: -462.471830 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.471830 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.471830 (E_RNA) where: Base-Base interactions energy: -311.392 where: short stacking energy: -145.674 Base-Backbone interact. energy: -0.007 local terms energy: -151.072951 where: bonds (distance) C4'-P energy: -24.901 bonds (distance) P-C4' energy: -25.623 flat angles C4'-P-C4' energy: -33.768 flat angles P-C4'-P energy: -21.123 tors. eta vs tors. theta energy: -45.657 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 71 Temperature: 0.950000 Total energy: -452.364652 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.364652 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.364652 (E_RNA) where: Base-Base interactions energy: -316.154 where: short stacking energy: -139.433 Base-Backbone interact. energy: -0.066 local terms energy: -136.144903 where: bonds (distance) C4'-P energy: -23.040 bonds (distance) P-C4' energy: -21.028 flat angles C4'-P-C4' energy: -30.809 flat angles P-C4'-P energy: -19.189 tors. eta vs tors. theta energy: -42.079 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 3 ===================================== Write number: 71 Temperature: 1.000000 Total energy: -423.972563 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.972563 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.972563 (E_RNA) where: Base-Base interactions energy: -285.853 where: short stacking energy: -130.921 Base-Backbone interact. energy: -0.583 local terms energy: -137.536623 where: bonds (distance) C4'-P energy: -23.961 bonds (distance) P-C4' energy: -28.310 flat angles C4'-P-C4' energy: -31.131 flat angles P-C4'-P energy: -19.965 tors. eta vs tors. theta energy: -34.169 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 71 Temperature: 1.050000 Total energy: -435.034204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.034204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.034204 (E_RNA) where: Base-Base interactions energy: -297.686 where: short stacking energy: -133.254 Base-Backbone interact. energy: -1.342 local terms energy: -136.005533 where: bonds (distance) C4'-P energy: -17.816 bonds (distance) P-C4' energy: -26.418 flat angles C4'-P-C4' energy: -29.856 flat angles P-C4'-P energy: -21.152 tors. eta vs tors. theta energy: -40.764 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 71 Temperature: 1.100000 Total energy: -434.760529 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -434.760529 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -434.760529 (E_RNA) where: Base-Base interactions energy: -307.149 where: short stacking energy: -128.916 Base-Backbone interact. energy: 2.179 local terms energy: -129.790133 where: bonds (distance) C4'-P energy: -23.315 bonds (distance) P-C4' energy: -25.706 flat angles C4'-P-C4' energy: -29.093 flat angles P-C4'-P energy: -16.144 tors. eta vs tors. theta energy: -35.533 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 71 Temperature: 1.150000 Total energy: -347.227931 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -347.227931 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -347.227931 (E_RNA) where: Base-Base interactions energy: -237.942 where: short stacking energy: -123.111 Base-Backbone interact. energy: -0.014 local terms energy: -109.272387 where: bonds (distance) C4'-P energy: -24.348 bonds (distance) P-C4' energy: -24.977 flat angles C4'-P-C4' energy: -16.262 flat angles P-C4'-P energy: -13.613 tors. eta vs tors. theta energy: -30.072 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 71 Temperature: 1.200000 Total energy: -280.518355 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -280.518355 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -280.518355 (E_RNA) where: Base-Base interactions energy: -178.819 where: short stacking energy: -81.186 Base-Backbone interact. energy: -0.101 local terms energy: -101.597897 where: bonds (distance) C4'-P energy: -24.135 bonds (distance) P-C4' energy: -29.784 flat angles C4'-P-C4' energy: -22.426 flat angles P-C4'-P energy: -10.462 tors. eta vs tors. theta energy: -14.790 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 71 Temperature: 1.250000 Total energy: -235.897342 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.897342 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.897342 (E_RNA) where: Base-Base interactions energy: -141.339 where: short stacking energy: -79.199 Base-Backbone interact. energy: -0.495 local terms energy: -94.062822 where: bonds (distance) C4'-P energy: -22.198 bonds (distance) P-C4' energy: -24.287 flat angles C4'-P-C4' energy: -21.747 flat angles P-C4'-P energy: -12.185 tors. eta vs tors. theta energy: -13.645 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 71 Temperature: 1.300000 Total energy: -228.199487 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.199487 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.199487 (E_RNA) where: Base-Base interactions energy: -132.679 where: short stacking energy: -67.912 Base-Backbone interact. energy: -1.231 local terms energy: -94.289526 where: bonds (distance) C4'-P energy: -26.256 bonds (distance) P-C4' energy: -20.198 flat angles C4'-P-C4' energy: -22.445 flat angles P-C4'-P energy: -11.211 tors. eta vs tors. theta energy: -14.179 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 71 Temperature: 1.350000 Total energy: -148.763504 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -148.763504 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -148.763504 (E_RNA) where: Base-Base interactions energy: -69.679 where: short stacking energy: -70.036 Base-Backbone interact. energy: -0.179 local terms energy: -78.905697 where: bonds (distance) C4'-P energy: -21.940 bonds (distance) P-C4' energy: -19.475 flat angles C4'-P-C4' energy: -22.045 flat angles P-C4'-P energy: -3.761 tors. eta vs tors. theta energy: -11.684 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 72 Temperature: 0.900000 Total energy: -458.932607 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.932607 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.932607 (E_RNA) where: Base-Base interactions energy: -320.535 where: short stacking energy: -148.599 Base-Backbone interact. energy: -0.593 local terms energy: -137.804885 where: bonds (distance) C4'-P energy: -22.626 bonds (distance) P-C4' energy: -26.905 flat angles C4'-P-C4' energy: -29.475 flat angles P-C4'-P energy: -18.568 tors. eta vs tors. theta energy: -40.232 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 72 Temperature: 0.950000 Total energy: -452.489441 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -452.489441 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -452.489441 (E_RNA) where: Base-Base interactions energy: -307.882 where: short stacking energy: -150.249 Base-Backbone interact. energy: -0.455 local terms energy: -144.152906 where: bonds (distance) C4'-P energy: -24.393 bonds (distance) P-C4' energy: -22.352 flat angles C4'-P-C4' energy: -29.922 flat angles P-C4'-P energy: -22.363 tors. eta vs tors. theta energy: -45.123 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 72 Temperature: 1.000000 Total energy: -457.857999 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.857999 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.857999 (E_RNA) where: Base-Base interactions energy: -314.015 where: short stacking energy: -135.618 Base-Backbone interact. energy: -1.542 local terms energy: -142.300553 where: bonds (distance) C4'-P energy: -21.453 bonds (distance) P-C4' energy: -27.104 flat angles C4'-P-C4' energy: -28.663 flat angles P-C4'-P energy: -22.323 tors. eta vs tors. theta energy: -42.757 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 72 Temperature: 1.050000 Total energy: -435.042709 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -435.042709 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -435.042709 (E_RNA) where: Base-Base interactions energy: -292.227 where: short stacking energy: -131.933 Base-Backbone interact. energy: -1.980 local terms energy: -140.835849 where: bonds (distance) C4'-P energy: -27.845 bonds (distance) P-C4' energy: -25.766 flat angles C4'-P-C4' energy: -31.856 flat angles P-C4'-P energy: -20.853 tors. eta vs tors. theta energy: -34.516 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 72 Temperature: 1.100000 Total energy: -365.774413 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.774413 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.774413 (E_RNA) where: Base-Base interactions energy: -242.407 where: short stacking energy: -101.811 Base-Backbone interact. energy: -1.235 local terms energy: -122.132730 where: bonds (distance) C4'-P energy: -29.000 bonds (distance) P-C4' energy: -26.068 flat angles C4'-P-C4' energy: -26.710 flat angles P-C4'-P energy: -18.295 tors. eta vs tors. theta energy: -22.059 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 72 Temperature: 1.150000 Total energy: -411.763076 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -411.763076 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -411.763076 (E_RNA) where: Base-Base interactions energy: -295.362 where: short stacking energy: -129.097 Base-Backbone interact. energy: 1.404 local terms energy: -117.805018 where: bonds (distance) C4'-P energy: -20.371 bonds (distance) P-C4' energy: -22.726 flat angles C4'-P-C4' energy: -22.706 flat angles P-C4'-P energy: -18.932 tors. eta vs tors. theta energy: -33.070 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 72 Temperature: 1.200000 Total energy: -269.673718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.673718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.673718 (E_RNA) where: Base-Base interactions energy: -165.752 where: short stacking energy: -72.094 Base-Backbone interact. energy: -2.748 local terms energy: -101.174352 where: bonds (distance) C4'-P energy: -28.357 bonds (distance) P-C4' energy: -18.744 flat angles C4'-P-C4' energy: -26.053 flat angles P-C4'-P energy: -17.618 tors. eta vs tors. theta energy: -10.403 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 72 Temperature: 1.250000 Total energy: -260.800109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -260.800109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -260.800109 (E_RNA) where: Base-Base interactions energy: -159.791 where: short stacking energy: -90.860 Base-Backbone interact. energy: -0.444 local terms energy: -100.564560 where: bonds (distance) C4'-P energy: -19.959 bonds (distance) P-C4' energy: -19.018 flat angles C4'-P-C4' energy: -25.014 flat angles P-C4'-P energy: -19.044 tors. eta vs tors. theta energy: -17.529 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 72 Temperature: 1.300000 Total energy: -234.429128 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.429128 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.429128 (E_RNA) where: Base-Base interactions energy: -130.893 where: short stacking energy: -76.808 Base-Backbone interact. energy: -0.117 local terms energy: -103.418988 where: bonds (distance) C4'-P energy: -23.999 bonds (distance) P-C4' energy: -25.758 flat angles C4'-P-C4' energy: -24.248 flat angles P-C4'-P energy: -15.325 tors. eta vs tors. theta energy: -14.090 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 72 Temperature: 1.350000 Total energy: -146.498889 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -146.498889 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -146.498889 (E_RNA) where: Base-Base interactions energy: -65.019 where: short stacking energy: -54.597 Base-Backbone interact. energy: -0.200 local terms energy: -81.279591 where: bonds (distance) C4'-P energy: -24.371 bonds (distance) P-C4' energy: -20.005 flat angles C4'-P-C4' energy: -20.312 flat angles P-C4'-P energy: -13.894 tors. eta vs tors. theta energy: -2.698 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 73 Temperature: 0.900000 Total energy: -460.422235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.422235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.422235 (E_RNA) where: Base-Base interactions energy: -314.571 where: short stacking energy: -144.591 Base-Backbone interact. energy: -0.757 local terms energy: -145.094111 where: bonds (distance) C4'-P energy: -29.825 bonds (distance) P-C4' energy: -28.959 flat angles C4'-P-C4' energy: -29.946 flat angles P-C4'-P energy: -18.273 tors. eta vs tors. theta energy: -38.091 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 73 Temperature: 0.950000 Total energy: -450.515263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.515263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.515263 (E_RNA) where: Base-Base interactions energy: -304.639 where: short stacking energy: -136.525 Base-Backbone interact. energy: -2.588 local terms energy: -143.288564 where: bonds (distance) C4'-P energy: -23.545 bonds (distance) P-C4' energy: -26.338 flat angles C4'-P-C4' energy: -29.328 flat angles P-C4'-P energy: -24.460 tors. eta vs tors. theta energy: -39.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 73 Temperature: 1.000000 Total energy: -445.796374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.796374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.796374 (E_RNA) where: Base-Base interactions energy: -301.863 where: short stacking energy: -146.006 Base-Backbone interact. energy: -0.654 local terms energy: -143.279144 where: bonds (distance) C4'-P energy: -25.095 bonds (distance) P-C4' energy: -24.664 flat angles C4'-P-C4' energy: -31.250 flat angles P-C4'-P energy: -19.215 tors. eta vs tors. theta energy: -43.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 73 Temperature: 1.050000 Total energy: -414.196550 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.196550 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.196550 (E_RNA) where: Base-Base interactions energy: -285.437 where: short stacking energy: -135.063 Base-Backbone interact. energy: 0.087 local terms energy: -128.847303 where: bonds (distance) C4'-P energy: -23.403 bonds (distance) P-C4' energy: -25.645 flat angles C4'-P-C4' energy: -25.855 flat angles P-C4'-P energy: -21.132 tors. eta vs tors. theta energy: -32.812 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 73 Temperature: 1.100000 Total energy: -386.515857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -386.515857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -386.515857 (E_RNA) where: Base-Base interactions energy: -263.589 where: short stacking energy: -121.839 Base-Backbone interact. energy: 0.151 local terms energy: -123.077097 where: bonds (distance) C4'-P energy: -26.465 bonds (distance) P-C4' energy: -16.277 flat angles C4'-P-C4' energy: -27.931 flat angles P-C4'-P energy: -20.381 tors. eta vs tors. theta energy: -32.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 2 ===================================== Write number: 73 Temperature: 1.150000 Total energy: -414.371449 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.371449 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.371449 (E_RNA) where: Base-Base interactions energy: -292.829 where: short stacking energy: -123.430 Base-Backbone interact. energy: 1.436 local terms energy: -122.978945 where: bonds (distance) C4'-P energy: -20.733 bonds (distance) P-C4' energy: -25.958 flat angles C4'-P-C4' energy: -28.489 flat angles P-C4'-P energy: -18.169 tors. eta vs tors. theta energy: -29.630 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 73 Temperature: 1.200000 Total energy: -299.720962 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -299.720962 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -299.720962 (E_RNA) where: Base-Base interactions energy: -201.552 where: short stacking energy: -87.000 Base-Backbone interact. energy: -0.784 local terms energy: -97.384666 where: bonds (distance) C4'-P energy: -24.967 bonds (distance) P-C4' energy: -17.252 flat angles C4'-P-C4' energy: -21.413 flat angles P-C4'-P energy: -13.881 tors. eta vs tors. theta energy: -19.873 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 73 Temperature: 1.250000 Total energy: -255.308232 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -255.308232 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -255.308232 (E_RNA) where: Base-Base interactions energy: -146.646 where: short stacking energy: -82.395 Base-Backbone interact. energy: -0.104 local terms energy: -108.558234 where: bonds (distance) C4'-P energy: -19.097 bonds (distance) P-C4' energy: -27.551 flat angles C4'-P-C4' energy: -24.343 flat angles P-C4'-P energy: -16.853 tors. eta vs tors. theta energy: -20.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 73 Temperature: 1.300000 Total energy: -223.671613 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.671613 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.671613 (E_RNA) where: Base-Base interactions energy: -133.596 where: short stacking energy: -57.603 Base-Backbone interact. energy: -0.270 local terms energy: -89.805507 where: bonds (distance) C4'-P energy: -17.952 bonds (distance) P-C4' energy: -24.627 flat angles C4'-P-C4' energy: -23.570 flat angles P-C4'-P energy: -14.043 tors. eta vs tors. theta energy: -9.614 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 73 Temperature: 1.350000 Total energy: -140.459514 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -140.459514 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -140.459514 (E_RNA) where: Base-Base interactions energy: -66.129 where: short stacking energy: -48.465 Base-Backbone interact. energy: -0.393 local terms energy: -73.937402 where: bonds (distance) C4'-P energy: -16.525 bonds (distance) P-C4' energy: -17.384 flat angles C4'-P-C4' energy: -21.502 flat angles P-C4'-P energy: -12.271 tors. eta vs tors. theta energy: -6.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 74 Temperature: 0.900000 Total energy: -453.037348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.037348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.037348 (E_RNA) where: Base-Base interactions energy: -308.807 where: short stacking energy: -144.399 Base-Backbone interact. energy: -0.995 local terms energy: -143.235705 where: bonds (distance) C4'-P energy: -27.251 bonds (distance) P-C4' energy: -23.633 flat angles C4'-P-C4' energy: -29.973 flat angles P-C4'-P energy: -18.038 tors. eta vs tors. theta energy: -44.340 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 74 Temperature: 0.950000 Total energy: -460.143706 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.143706 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.143706 (E_RNA) where: Base-Base interactions energy: -312.510 where: short stacking energy: -149.491 Base-Backbone interact. energy: -1.382 local terms energy: -146.251794 where: bonds (distance) C4'-P energy: -22.612 bonds (distance) P-C4' energy: -29.603 flat angles C4'-P-C4' energy: -31.375 flat angles P-C4'-P energy: -21.306 tors. eta vs tors. theta energy: -41.356 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 74 Temperature: 1.000000 Total energy: -441.579891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.579891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.579891 (E_RNA) where: Base-Base interactions energy: -311.328 where: short stacking energy: -139.223 Base-Backbone interact. energy: -0.095 local terms energy: -130.156563 where: bonds (distance) C4'-P energy: -21.270 bonds (distance) P-C4' energy: -28.840 flat angles C4'-P-C4' energy: -30.361 flat angles P-C4'-P energy: -12.805 tors. eta vs tors. theta energy: -36.881 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 74 Temperature: 1.050000 Total energy: -424.577359 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.577359 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.577359 (E_RNA) where: Base-Base interactions energy: -291.144 where: short stacking energy: -131.798 Base-Backbone interact. energy: -0.212 local terms energy: -133.220982 where: bonds (distance) C4'-P energy: -22.685 bonds (distance) P-C4' energy: -26.490 flat angles C4'-P-C4' energy: -30.184 flat angles P-C4'-P energy: -17.434 tors. eta vs tors. theta energy: -36.429 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 74 Temperature: 1.100000 Total energy: -415.784407 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -415.784407 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -415.784407 (E_RNA) where: Base-Base interactions energy: -286.204 where: short stacking energy: -126.342 Base-Backbone interact. energy: 0.363 local terms energy: -129.944119 where: bonds (distance) C4'-P energy: -22.996 bonds (distance) P-C4' energy: -26.319 flat angles C4'-P-C4' energy: -27.729 flat angles P-C4'-P energy: -17.208 tors. eta vs tors. theta energy: -35.692 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 74 Temperature: 1.150000 Total energy: -383.745804 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -383.745804 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -383.745804 (E_RNA) where: Base-Base interactions energy: -251.881 where: short stacking energy: -109.071 Base-Backbone interact. energy: -1.235 local terms energy: -130.630770 where: bonds (distance) C4'-P energy: -25.382 bonds (distance) P-C4' energy: -23.614 flat angles C4'-P-C4' energy: -30.503 flat angles P-C4'-P energy: -19.495 tors. eta vs tors. theta energy: -31.637 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 74 Temperature: 1.200000 Total energy: -302.491806 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.491806 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.491806 (E_RNA) where: Base-Base interactions energy: -199.896 where: short stacking energy: -87.360 Base-Backbone interact. energy: -3.242 local terms energy: -99.353908 where: bonds (distance) C4'-P energy: -20.919 bonds (distance) P-C4' energy: -27.160 flat angles C4'-P-C4' energy: -17.484 flat angles P-C4'-P energy: -13.685 tors. eta vs tors. theta energy: -20.105 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 74 Temperature: 1.250000 Total energy: -237.736523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -237.736523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -237.736523 (E_RNA) where: Base-Base interactions energy: -141.816 where: short stacking energy: -73.866 Base-Backbone interact. energy: -0.420 local terms energy: -95.500392 where: bonds (distance) C4'-P energy: -16.503 bonds (distance) P-C4' energy: -24.370 flat angles C4'-P-C4' energy: -26.213 flat angles P-C4'-P energy: -11.705 tors. eta vs tors. theta energy: -16.710 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 74 Temperature: 1.300000 Total energy: -210.776194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -210.776194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -210.776194 (E_RNA) where: Base-Base interactions energy: -137.206 where: short stacking energy: -59.575 Base-Backbone interact. energy: -1.111 local terms energy: -72.458998 where: bonds (distance) C4'-P energy: -22.348 bonds (distance) P-C4' energy: -15.770 flat angles C4'-P-C4' energy: -23.061 flat angles P-C4'-P energy: -9.180 tors. eta vs tors. theta energy: -2.101 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 74 Temperature: 1.350000 Total energy: -126.350250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -126.350250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -126.350250 (E_RNA) where: Base-Base interactions energy: -45.935 where: short stacking energy: -38.864 Base-Backbone interact. energy: -0.211 local terms energy: -80.203977 where: bonds (distance) C4'-P energy: -26.736 bonds (distance) P-C4' energy: -27.921 flat angles C4'-P-C4' energy: -15.609 flat angles P-C4'-P energy: -14.092 tors. eta vs tors. theta energy: 4.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 75 Temperature: 0.900000 Total energy: -460.956747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.956747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.956747 (E_RNA) where: Base-Base interactions energy: -316.693 where: short stacking energy: -145.360 Base-Backbone interact. energy: -0.585 local terms energy: -143.679072 where: bonds (distance) C4'-P energy: -24.377 bonds (distance) P-C4' energy: -28.408 flat angles C4'-P-C4' energy: -28.061 flat angles P-C4'-P energy: -20.977 tors. eta vs tors. theta energy: -41.856 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 75 Temperature: 0.950000 Total energy: -453.518290 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.518290 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.518290 (E_RNA) where: Base-Base interactions energy: -311.160 where: short stacking energy: -139.180 Base-Backbone interact. energy: 0.617 local terms energy: -142.975333 where: bonds (distance) C4'-P energy: -26.829 bonds (distance) P-C4' energy: -27.899 flat angles C4'-P-C4' energy: -28.966 flat angles P-C4'-P energy: -19.833 tors. eta vs tors. theta energy: -39.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 75 Temperature: 1.000000 Total energy: -425.503077 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -425.503077 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -425.503077 (E_RNA) where: Base-Base interactions energy: -291.829 where: short stacking energy: -133.301 Base-Backbone interact. energy: -0.266 local terms energy: -133.408199 where: bonds (distance) C4'-P energy: -21.469 bonds (distance) P-C4' energy: -27.158 flat angles C4'-P-C4' energy: -26.448 flat angles P-C4'-P energy: -22.518 tors. eta vs tors. theta energy: -35.815 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 75 Temperature: 1.050000 Total energy: -446.397235 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.397235 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.397235 (E_RNA) where: Base-Base interactions energy: -308.540 where: short stacking energy: -126.081 Base-Backbone interact. energy: -1.110 local terms energy: -136.747882 where: bonds (distance) C4'-P energy: -24.139 bonds (distance) P-C4' energy: -27.469 flat angles C4'-P-C4' energy: -25.265 flat angles P-C4'-P energy: -21.253 tors. eta vs tors. theta energy: -38.622 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 75 Temperature: 1.100000 Total energy: -410.365198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.365198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.365198 (E_RNA) where: Base-Base interactions energy: -270.034 where: short stacking energy: -129.816 Base-Backbone interact. energy: -1.520 local terms energy: -138.812125 where: bonds (distance) C4'-P energy: -23.863 bonds (distance) P-C4' energy: -28.065 flat angles C4'-P-C4' energy: -29.642 flat angles P-C4'-P energy: -22.304 tors. eta vs tors. theta energy: -34.938 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 75 Temperature: 1.150000 Total energy: -328.636711 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -328.636711 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -328.636711 (E_RNA) where: Base-Base interactions energy: -229.936 where: short stacking energy: -109.970 Base-Backbone interact. energy: -0.941 local terms energy: -97.759867 where: bonds (distance) C4'-P energy: -19.486 bonds (distance) P-C4' energy: -24.431 flat angles C4'-P-C4' energy: -25.479 flat angles P-C4'-P energy: -7.687 tors. eta vs tors. theta energy: -20.676 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 75 Temperature: 1.200000 Total energy: -358.809296 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -358.809296 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -358.809296 (E_RNA) where: Base-Base interactions energy: -247.435 where: short stacking energy: -120.789 Base-Backbone interact. energy: -0.167 local terms energy: -111.207691 where: bonds (distance) C4'-P energy: -23.949 bonds (distance) P-C4' energy: -19.855 flat angles C4'-P-C4' energy: -24.770 flat angles P-C4'-P energy: -13.738 tors. eta vs tors. theta energy: -28.896 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 75 Temperature: 1.250000 Total energy: -244.249624 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.249624 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.249624 (E_RNA) where: Base-Base interactions energy: -148.511 where: short stacking energy: -74.043 Base-Backbone interact. energy: 0.492 local terms energy: -96.229964 where: bonds (distance) C4'-P energy: -20.761 bonds (distance) P-C4' energy: -28.289 flat angles C4'-P-C4' energy: -18.722 flat angles P-C4'-P energy: -13.324 tors. eta vs tors. theta energy: -15.133 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 75 Temperature: 1.300000 Total energy: -235.876102 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.876102 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.876102 (E_RNA) where: Base-Base interactions energy: -142.284 where: short stacking energy: -72.799 Base-Backbone interact. energy: -0.237 local terms energy: -93.355039 where: bonds (distance) C4'-P energy: -20.090 bonds (distance) P-C4' energy: -17.438 flat angles C4'-P-C4' energy: -20.169 flat angles P-C4'-P energy: -15.757 tors. eta vs tors. theta energy: -19.900 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 75 Temperature: 1.350000 Total energy: -154.465998 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -154.465998 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -154.465998 (E_RNA) where: Base-Base interactions energy: -59.975 where: short stacking energy: -59.975 Base-Backbone interact. energy: -0.115 local terms energy: -94.376048 where: bonds (distance) C4'-P energy: -24.259 bonds (distance) P-C4' energy: -28.517 flat angles C4'-P-C4' energy: -21.235 flat angles P-C4'-P energy: -9.868 tors. eta vs tors. theta energy: -10.498 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 76 Temperature: 0.900000 Total energy: -463.535343 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.535343 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.535343 (E_RNA) where: Base-Base interactions energy: -322.159 where: short stacking energy: -143.901 Base-Backbone interact. energy: -0.273 local terms energy: -141.103372 where: bonds (distance) C4'-P energy: -25.921 bonds (distance) P-C4' energy: -23.465 flat angles C4'-P-C4' energy: -27.804 flat angles P-C4'-P energy: -22.459 tors. eta vs tors. theta energy: -41.456 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 76 Temperature: 0.950000 Total energy: -459.158731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.158731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.158731 (E_RNA) where: Base-Base interactions energy: -317.774 where: short stacking energy: -145.165 Base-Backbone interact. energy: -0.157 local terms energy: -141.227248 where: bonds (distance) C4'-P energy: -28.010 bonds (distance) P-C4' energy: -24.692 flat angles C4'-P-C4' energy: -24.508 flat angles P-C4'-P energy: -20.458 tors. eta vs tors. theta energy: -43.558 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 76 Temperature: 1.000000 Total energy: -451.106260 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.106260 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.106260 (E_RNA) where: Base-Base interactions energy: -328.099 where: short stacking energy: -137.816 Base-Backbone interact. energy: -1.213 local terms energy: -121.794243 where: bonds (distance) C4'-P energy: -24.625 bonds (distance) P-C4' energy: -19.030 flat angles C4'-P-C4' energy: -25.621 flat angles P-C4'-P energy: -18.170 tors. eta vs tors. theta energy: -34.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 76 Temperature: 1.050000 Total energy: -437.201966 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.201966 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.201966 (E_RNA) where: Base-Base interactions energy: -296.083 where: short stacking energy: -133.416 Base-Backbone interact. energy: -0.617 local terms energy: -140.501640 where: bonds (distance) C4'-P energy: -28.276 bonds (distance) P-C4' energy: -25.997 flat angles C4'-P-C4' energy: -26.656 flat angles P-C4'-P energy: -22.158 tors. eta vs tors. theta energy: -37.415 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 76 Temperature: 1.100000 Total energy: -392.961116 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -392.961116 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -392.961116 (E_RNA) where: Base-Base interactions energy: -260.813 where: short stacking energy: -124.697 Base-Backbone interact. energy: -0.465 local terms energy: -131.682970 where: bonds (distance) C4'-P energy: -25.804 bonds (distance) P-C4' energy: -30.237 flat angles C4'-P-C4' energy: -26.583 flat angles P-C4'-P energy: -17.374 tors. eta vs tors. theta energy: -31.685 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 76 Temperature: 1.150000 Total energy: -291.092523 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.092523 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.092523 (E_RNA) where: Base-Base interactions energy: -182.241 where: short stacking energy: -82.647 Base-Backbone interact. energy: -1.266 local terms energy: -107.585883 where: bonds (distance) C4'-P energy: -19.500 bonds (distance) P-C4' energy: -25.138 flat angles C4'-P-C4' energy: -24.515 flat angles P-C4'-P energy: -17.854 tors. eta vs tors. theta energy: -20.579 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 9 ===================================== Write number: 76 Temperature: 1.200000 Total energy: -343.625964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.625964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.625964 (E_RNA) where: Base-Base interactions energy: -230.677 where: short stacking energy: -101.322 Base-Backbone interact. energy: -2.687 local terms energy: -110.261974 where: bonds (distance) C4'-P energy: -24.303 bonds (distance) P-C4' energy: -25.639 flat angles C4'-P-C4' energy: -24.038 flat angles P-C4'-P energy: -13.218 tors. eta vs tors. theta energy: -23.064 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 76 Temperature: 1.250000 Total energy: -252.806920 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.806920 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.806920 (E_RNA) where: Base-Base interactions energy: -156.485 where: short stacking energy: -68.525 Base-Backbone interact. energy: -0.845 local terms energy: -95.476843 where: bonds (distance) C4'-P energy: -18.367 bonds (distance) P-C4' energy: -21.960 flat angles C4'-P-C4' energy: -24.640 flat angles P-C4'-P energy: -18.270 tors. eta vs tors. theta energy: -12.240 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 76 Temperature: 1.300000 Total energy: -243.579870 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.579870 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.579870 (E_RNA) where: Base-Base interactions energy: -145.533 where: short stacking energy: -78.382 Base-Backbone interact. energy: -0.248 local terms energy: -97.798950 where: bonds (distance) C4'-P energy: -20.765 bonds (distance) P-C4' energy: -29.557 flat angles C4'-P-C4' energy: -21.973 flat angles P-C4'-P energy: -11.490 tors. eta vs tors. theta energy: -14.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 76 Temperature: 1.350000 Total energy: -138.940708 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -138.940708 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -138.940708 (E_RNA) where: Base-Base interactions energy: -61.188 where: short stacking energy: -48.479 Base-Backbone interact. energy: 0.356 local terms energy: -78.109155 where: bonds (distance) C4'-P energy: -18.946 bonds (distance) P-C4' energy: -24.457 flat angles C4'-P-C4' energy: -27.204 flat angles P-C4'-P energy: -4.618 tors. eta vs tors. theta energy: -2.885 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 77 Temperature: 0.900000 Total energy: -468.163672 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.163672 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.163672 (E_RNA) where: Base-Base interactions energy: -322.586 where: short stacking energy: -141.995 Base-Backbone interact. energy: -0.065 local terms energy: -145.512170 where: bonds (distance) C4'-P energy: -24.441 bonds (distance) P-C4' energy: -31.284 flat angles C4'-P-C4' energy: -25.367 flat angles P-C4'-P energy: -21.135 tors. eta vs tors. theta energy: -43.284 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 77 Temperature: 0.950000 Total energy: -461.619940 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.619940 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.619940 (E_RNA) where: Base-Base interactions energy: -328.962 where: short stacking energy: -136.458 Base-Backbone interact. energy: -1.569 local terms energy: -131.089025 where: bonds (distance) C4'-P energy: -28.177 bonds (distance) P-C4' energy: -25.913 flat angles C4'-P-C4' energy: -26.866 flat angles P-C4'-P energy: -14.890 tors. eta vs tors. theta energy: -35.243 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 77 Temperature: 1.000000 Total energy: -447.807700 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.807700 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.807700 (E_RNA) where: Base-Base interactions energy: -304.954 where: short stacking energy: -139.315 Base-Backbone interact. energy: -0.483 local terms energy: -142.370341 where: bonds (distance) C4'-P energy: -24.934 bonds (distance) P-C4' energy: -21.434 flat angles C4'-P-C4' energy: -33.191 flat angles P-C4'-P energy: -20.993 tors. eta vs tors. theta energy: -41.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 77 Temperature: 1.050000 Total energy: -410.180710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.180710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.180710 (E_RNA) where: Base-Base interactions energy: -273.946 where: short stacking energy: -129.366 Base-Backbone interact. energy: -1.050 local terms energy: -135.184905 where: bonds (distance) C4'-P energy: -21.879 bonds (distance) P-C4' energy: -26.478 flat angles C4'-P-C4' energy: -28.967 flat angles P-C4'-P energy: -22.299 tors. eta vs tors. theta energy: -35.562 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 77 Temperature: 1.100000 Total energy: -426.972338 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -426.972338 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -426.972338 (E_RNA) where: Base-Base interactions energy: -295.063 where: short stacking energy: -127.454 Base-Backbone interact. energy: -0.603 local terms energy: -131.306323 where: bonds (distance) C4'-P energy: -23.236 bonds (distance) P-C4' energy: -23.830 flat angles C4'-P-C4' energy: -27.533 flat angles P-C4'-P energy: -17.453 tors. eta vs tors. theta energy: -39.253 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 77 Temperature: 1.150000 Total energy: -366.031678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -366.031678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -366.031678 (E_RNA) where: Base-Base interactions energy: -251.926 where: short stacking energy: -110.967 Base-Backbone interact. energy: -0.712 local terms energy: -113.393355 where: bonds (distance) C4'-P energy: -15.000 bonds (distance) P-C4' energy: -21.958 flat angles C4'-P-C4' energy: -30.251 flat angles P-C4'-P energy: -18.653 tors. eta vs tors. theta energy: -27.530 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 77 Temperature: 1.200000 Total energy: -289.499641 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -289.499641 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -289.499641 (E_RNA) where: Base-Base interactions energy: -182.777 where: short stacking energy: -98.059 Base-Backbone interact. energy: -0.235 local terms energy: -106.487978 where: bonds (distance) C4'-P energy: -21.267 bonds (distance) P-C4' energy: -29.995 flat angles C4'-P-C4' energy: -24.297 flat angles P-C4'-P energy: -11.017 tors. eta vs tors. theta energy: -19.911 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 77 Temperature: 1.250000 Total energy: -246.963377 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.963377 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.963377 (E_RNA) where: Base-Base interactions energy: -158.012 where: short stacking energy: -77.894 Base-Backbone interact. energy: -0.750 local terms energy: -88.200877 where: bonds (distance) C4'-P energy: -21.487 bonds (distance) P-C4' energy: -18.836 flat angles C4'-P-C4' energy: -21.698 flat angles P-C4'-P energy: -13.578 tors. eta vs tors. theta energy: -12.602 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 77 Temperature: 1.300000 Total energy: -245.835938 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.835938 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.835938 (E_RNA) where: Base-Base interactions energy: -156.176 where: short stacking energy: -87.824 Base-Backbone interact. energy: -0.577 local terms energy: -89.083536 where: bonds (distance) C4'-P energy: -19.836 bonds (distance) P-C4' energy: -26.749 flat angles C4'-P-C4' energy: -23.617 flat angles P-C4'-P energy: -3.295 tors. eta vs tors. theta energy: -15.588 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 77 Temperature: 1.350000 Total energy: -132.697955 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.697955 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.697955 (E_RNA) where: Base-Base interactions energy: -54.463 where: short stacking energy: -50.834 Base-Backbone interact. energy: 0.489 local terms energy: -78.723814 where: bonds (distance) C4'-P energy: -23.073 bonds (distance) P-C4' energy: -27.224 flat angles C4'-P-C4' energy: -17.479 flat angles P-C4'-P energy: -12.499 tors. eta vs tors. theta energy: 1.551 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 78 Temperature: 0.900000 Total energy: -471.051530 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.051530 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.051530 (E_RNA) where: Base-Base interactions energy: -324.683 where: short stacking energy: -148.007 Base-Backbone interact. energy: -0.350 local terms energy: -146.018432 where: bonds (distance) C4'-P energy: -23.353 bonds (distance) P-C4' energy: -29.561 flat angles C4'-P-C4' energy: -32.674 flat angles P-C4'-P energy: -20.529 tors. eta vs tors. theta energy: -39.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 78 Temperature: 0.950000 Total energy: -450.807843 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.807843 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.807843 (E_RNA) where: Base-Base interactions energy: -305.117 where: short stacking energy: -130.186 Base-Backbone interact. energy: -0.192 local terms energy: -145.498919 where: bonds (distance) C4'-P energy: -27.815 bonds (distance) P-C4' energy: -27.269 flat angles C4'-P-C4' energy: -29.123 flat angles P-C4'-P energy: -23.238 tors. eta vs tors. theta energy: -38.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 78 Temperature: 1.000000 Total energy: -450.011083 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.011083 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.011083 (E_RNA) where: Base-Base interactions energy: -314.213 where: short stacking energy: -139.529 Base-Backbone interact. energy: -0.033 local terms energy: -135.765804 where: bonds (distance) C4'-P energy: -21.982 bonds (distance) P-C4' energy: -25.138 flat angles C4'-P-C4' energy: -28.675 flat angles P-C4'-P energy: -18.481 tors. eta vs tors. theta energy: -41.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 78 Temperature: 1.050000 Total energy: -422.779680 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -422.779680 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -422.779680 (E_RNA) where: Base-Base interactions energy: -285.614 where: short stacking energy: -135.028 Base-Backbone interact. energy: 0.007 local terms energy: -137.172404 where: bonds (distance) C4'-P energy: -21.734 bonds (distance) P-C4' energy: -28.123 flat angles C4'-P-C4' energy: -30.040 flat angles P-C4'-P energy: -19.108 tors. eta vs tors. theta energy: -38.167 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 78 Temperature: 1.100000 Total energy: -379.923366 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.923366 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.923366 (E_RNA) where: Base-Base interactions energy: -254.329 where: short stacking energy: -112.777 Base-Backbone interact. energy: -1.415 local terms energy: -124.180023 where: bonds (distance) C4'-P energy: -23.270 bonds (distance) P-C4' energy: -28.535 flat angles C4'-P-C4' energy: -26.365 flat angles P-C4'-P energy: -14.335 tors. eta vs tors. theta energy: -31.675 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 78 Temperature: 1.150000 Total energy: -416.918839 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.918839 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.918839 (E_RNA) where: Base-Base interactions energy: -296.286 where: short stacking energy: -140.524 Base-Backbone interact. energy: -1.138 local terms energy: -119.495572 where: bonds (distance) C4'-P energy: -19.267 bonds (distance) P-C4' energy: -19.913 flat angles C4'-P-C4' energy: -25.212 flat angles P-C4'-P energy: -18.695 tors. eta vs tors. theta energy: -36.409 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 78 Temperature: 1.200000 Total energy: -303.949329 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -303.949329 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -303.949329 (E_RNA) where: Base-Base interactions energy: -189.406 where: short stacking energy: -99.027 Base-Backbone interact. energy: -0.199 local terms energy: -114.344285 where: bonds (distance) C4'-P energy: -25.840 bonds (distance) P-C4' energy: -25.924 flat angles C4'-P-C4' energy: -25.966 flat angles P-C4'-P energy: -14.537 tors. eta vs tors. theta energy: -22.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 78 Temperature: 1.250000 Total energy: -241.955474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -241.955474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -241.955474 (E_RNA) where: Base-Base interactions energy: -141.350 where: short stacking energy: -77.040 Base-Backbone interact. energy: -0.399 local terms energy: -100.206901 where: bonds (distance) C4'-P energy: -12.019 bonds (distance) P-C4' energy: -29.199 flat angles C4'-P-C4' energy: -24.101 flat angles P-C4'-P energy: -19.225 tors. eta vs tors. theta energy: -15.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 78 Temperature: 1.300000 Total energy: -246.102621 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.102621 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.102621 (E_RNA) where: Base-Base interactions energy: -149.231 where: short stacking energy: -82.512 Base-Backbone interact. energy: -0.075 local terms energy: -96.796150 where: bonds (distance) C4'-P energy: -21.935 bonds (distance) P-C4' energy: -24.690 flat angles C4'-P-C4' energy: -17.536 flat angles P-C4'-P energy: -13.859 tors. eta vs tors. theta energy: -18.777 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 78 Temperature: 1.350000 Total energy: -135.549119 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -135.549119 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -135.549119 (E_RNA) where: Base-Base interactions energy: -46.834 where: short stacking energy: -42.085 Base-Backbone interact. energy: 0.385 local terms energy: -89.100245 where: bonds (distance) C4'-P energy: -22.902 bonds (distance) P-C4' energy: -26.375 flat angles C4'-P-C4' energy: -24.349 flat angles P-C4'-P energy: -14.227 tors. eta vs tors. theta energy: -1.246 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 79 Temperature: 0.900000 Total energy: -471.776182 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -471.776182 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -471.776182 (E_RNA) where: Base-Base interactions energy: -328.731 where: short stacking energy: -150.440 Base-Backbone interact. energy: 2.789 local terms energy: -145.833959 where: bonds (distance) C4'-P energy: -29.701 bonds (distance) P-C4' energy: -29.350 flat angles C4'-P-C4' energy: -28.648 flat angles P-C4'-P energy: -20.048 tors. eta vs tors. theta energy: -38.086 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 79 Temperature: 0.950000 Total energy: -461.994942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -461.994942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -461.994942 (E_RNA) where: Base-Base interactions energy: -306.118 where: short stacking energy: -146.576 Base-Backbone interact. energy: -0.708 local terms energy: -155.169142 where: bonds (distance) C4'-P energy: -29.055 bonds (distance) P-C4' energy: -29.091 flat angles C4'-P-C4' energy: -33.087 flat angles P-C4'-P energy: -18.561 tors. eta vs tors. theta energy: -45.375 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 79 Temperature: 1.000000 Total energy: -447.505030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.505030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.505030 (E_RNA) where: Base-Base interactions energy: -315.948 where: short stacking energy: -145.157 Base-Backbone interact. energy: -0.313 local terms energy: -131.244425 where: bonds (distance) C4'-P energy: -21.710 bonds (distance) P-C4' energy: -20.650 flat angles C4'-P-C4' energy: -26.642 flat angles P-C4'-P energy: -21.004 tors. eta vs tors. theta energy: -41.238 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 79 Temperature: 1.050000 Total energy: -404.249627 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.249627 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.249627 (E_RNA) where: Base-Base interactions energy: -272.356 where: short stacking energy: -122.197 Base-Backbone interact. energy: -1.028 local terms energy: -130.865343 where: bonds (distance) C4'-P energy: -21.605 bonds (distance) P-C4' energy: -23.535 flat angles C4'-P-C4' energy: -31.323 flat angles P-C4'-P energy: -19.031 tors. eta vs tors. theta energy: -35.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 79 Temperature: 1.100000 Total energy: -377.187512 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.187512 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.187512 (E_RNA) where: Base-Base interactions energy: -253.992 where: short stacking energy: -117.626 Base-Backbone interact. energy: -1.229 local terms energy: -121.966222 where: bonds (distance) C4'-P energy: -25.503 bonds (distance) P-C4' energy: -27.807 flat angles C4'-P-C4' energy: -23.651 flat angles P-C4'-P energy: -12.174 tors. eta vs tors. theta energy: -32.833 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 1 ===================================== Write number: 79 Temperature: 1.150000 Total energy: -419.756662 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -419.756662 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -419.756662 (E_RNA) where: Base-Base interactions energy: -286.937 where: short stacking energy: -126.915 Base-Backbone interact. energy: 0.489 local terms energy: -133.308444 where: bonds (distance) C4'-P energy: -20.769 bonds (distance) P-C4' energy: -28.328 flat angles C4'-P-C4' energy: -29.756 flat angles P-C4'-P energy: -17.506 tors. eta vs tors. theta energy: -36.948 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 79 Temperature: 1.200000 Total energy: -307.996324 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -307.996324 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -307.996324 (E_RNA) where: Base-Base interactions energy: -186.477 where: short stacking energy: -93.532 Base-Backbone interact. energy: -1.301 local terms energy: -120.218783 where: bonds (distance) C4'-P energy: -21.650 bonds (distance) P-C4' energy: -28.389 flat angles C4'-P-C4' energy: -27.212 flat angles P-C4'-P energy: -17.975 tors. eta vs tors. theta energy: -24.994 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 79 Temperature: 1.250000 Total energy: -244.764015 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.764015 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.764015 (E_RNA) where: Base-Base interactions energy: -145.953 where: short stacking energy: -87.062 Base-Backbone interact. energy: -0.083 local terms energy: -98.727903 where: bonds (distance) C4'-P energy: -19.565 bonds (distance) P-C4' energy: -28.037 flat angles C4'-P-C4' energy: -28.193 flat angles P-C4'-P energy: -7.544 tors. eta vs tors. theta energy: -15.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 79 Temperature: 1.300000 Total energy: -240.195262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.195262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.195262 (E_RNA) where: Base-Base interactions energy: -154.181 where: short stacking energy: -66.964 Base-Backbone interact. energy: -0.685 local terms energy: -85.329226 where: bonds (distance) C4'-P energy: -22.746 bonds (distance) P-C4' energy: -19.592 flat angles C4'-P-C4' energy: -18.780 flat angles P-C4'-P energy: -10.558 tors. eta vs tors. theta energy: -13.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 79 Temperature: 1.350000 Total energy: -133.564247 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -133.564247 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -133.564247 (E_RNA) where: Base-Base interactions energy: -50.183 where: short stacking energy: -50.639 Base-Backbone interact. energy: -0.062 local terms energy: -83.319049 where: bonds (distance) C4'-P energy: -27.006 bonds (distance) P-C4' energy: -27.256 flat angles C4'-P-C4' energy: -21.156 flat angles P-C4'-P energy: -7.587 tors. eta vs tors. theta energy: -0.314 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 80 Temperature: 0.900000 Total energy: -464.612248 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.612248 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.612248 (E_RNA) where: Base-Base interactions energy: -315.509 where: short stacking energy: -142.059 Base-Backbone interact. energy: -0.529 local terms energy: -148.574401 where: bonds (distance) C4'-P energy: -29.104 bonds (distance) P-C4' energy: -27.371 flat angles C4'-P-C4' energy: -30.447 flat angles P-C4'-P energy: -18.639 tors. eta vs tors. theta energy: -43.014 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 80 Temperature: 0.950000 Total energy: -455.359206 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.359206 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.359206 (E_RNA) where: Base-Base interactions energy: -308.556 where: short stacking energy: -135.486 Base-Backbone interact. energy: -1.903 local terms energy: -144.900459 where: bonds (distance) C4'-P energy: -26.848 bonds (distance) P-C4' energy: -29.638 flat angles C4'-P-C4' energy: -27.729 flat angles P-C4'-P energy: -23.449 tors. eta vs tors. theta energy: -37.236 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 80 Temperature: 1.000000 Total energy: -433.933658 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.933658 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.933658 (E_RNA) where: Base-Base interactions energy: -298.490 where: short stacking energy: -121.997 Base-Backbone interact. energy: -0.197 local terms energy: -135.247325 where: bonds (distance) C4'-P energy: -26.060 bonds (distance) P-C4' energy: -26.409 flat angles C4'-P-C4' energy: -25.752 flat angles P-C4'-P energy: -18.490 tors. eta vs tors. theta energy: -38.537 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 80 Temperature: 1.050000 Total energy: -404.674744 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.674744 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.674744 (E_RNA) where: Base-Base interactions energy: -275.870 where: short stacking energy: -126.933 Base-Backbone interact. energy: -1.457 local terms energy: -127.347366 where: bonds (distance) C4'-P energy: -19.354 bonds (distance) P-C4' energy: -28.822 flat angles C4'-P-C4' energy: -26.548 flat angles P-C4'-P energy: -19.069 tors. eta vs tors. theta energy: -33.554 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 80 Temperature: 1.100000 Total energy: -414.319673 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -414.319673 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -414.319673 (E_RNA) where: Base-Base interactions energy: -291.220 where: short stacking energy: -134.787 Base-Backbone interact. energy: -0.011 local terms energy: -123.089241 where: bonds (distance) C4'-P energy: -18.346 bonds (distance) P-C4' energy: -26.581 flat angles C4'-P-C4' energy: -24.648 flat angles P-C4'-P energy: -16.612 tors. eta vs tors. theta energy: -36.903 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 80 Temperature: 1.150000 Total energy: -370.880805 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.880805 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.880805 (E_RNA) where: Base-Base interactions energy: -250.571 where: short stacking energy: -117.394 Base-Backbone interact. energy: -1.372 local terms energy: -118.938257 where: bonds (distance) C4'-P energy: -23.428 bonds (distance) P-C4' energy: -22.954 flat angles C4'-P-C4' energy: -25.077 flat angles P-C4'-P energy: -18.660 tors. eta vs tors. theta energy: -28.820 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 80 Temperature: 1.200000 Total energy: -232.645348 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.645348 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.645348 (E_RNA) where: Base-Base interactions energy: -134.547 where: short stacking energy: -89.940 Base-Backbone interact. energy: 0.691 local terms energy: -98.788689 where: bonds (distance) C4'-P energy: -15.273 bonds (distance) P-C4' energy: -27.714 flat angles C4'-P-C4' energy: -23.036 flat angles P-C4'-P energy: -15.559 tors. eta vs tors. theta energy: -17.207 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 80 Temperature: 1.250000 Total energy: -295.333316 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -295.333316 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -295.333316 (E_RNA) where: Base-Base interactions energy: -209.833 where: short stacking energy: -92.977 Base-Backbone interact. energy: 0.216 local terms energy: -85.715474 where: bonds (distance) C4'-P energy: -17.519 bonds (distance) P-C4' energy: -14.900 flat angles C4'-P-C4' energy: -22.085 flat angles P-C4'-P energy: -16.220 tors. eta vs tors. theta energy: -14.991 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 80 Temperature: 1.300000 Total energy: -248.775055 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.775055 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.775055 (E_RNA) where: Base-Base interactions energy: -158.206 where: short stacking energy: -67.430 Base-Backbone interact. energy: -0.276 local terms energy: -90.293557 where: bonds (distance) C4'-P energy: -22.064 bonds (distance) P-C4' energy: -20.978 flat angles C4'-P-C4' energy: -20.941 flat angles P-C4'-P energy: -18.179 tors. eta vs tors. theta energy: -8.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 80 Temperature: 1.350000 Total energy: -132.578262 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -132.578262 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -132.578262 (E_RNA) where: Base-Base interactions energy: -48.791 where: short stacking energy: -45.603 Base-Backbone interact. energy: -0.693 local terms energy: -83.094118 where: bonds (distance) C4'-P energy: -19.768 bonds (distance) P-C4' energy: -15.351 flat angles C4'-P-C4' energy: -22.583 flat angles P-C4'-P energy: -21.228 tors. eta vs tors. theta energy: -4.164 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 81 Temperature: 0.900000 Total energy: -466.001964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.001964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.001964 (E_RNA) where: Base-Base interactions energy: -317.578 where: short stacking energy: -144.169 Base-Backbone interact. energy: -0.229 local terms energy: -148.195122 where: bonds (distance) C4'-P energy: -25.296 bonds (distance) P-C4' energy: -25.217 flat angles C4'-P-C4' energy: -29.855 flat angles P-C4'-P energy: -23.038 tors. eta vs tors. theta energy: -44.789 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 81 Temperature: 0.950000 Total energy: -467.933517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.933517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.933517 (E_RNA) where: Base-Base interactions energy: -330.268 where: short stacking energy: -140.111 Base-Backbone interact. energy: -0.883 local terms energy: -136.782233 where: bonds (distance) C4'-P energy: -27.146 bonds (distance) P-C4' energy: -21.411 flat angles C4'-P-C4' energy: -29.249 flat angles P-C4'-P energy: -22.922 tors. eta vs tors. theta energy: -36.055 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 81 Temperature: 1.000000 Total energy: -444.050253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.050253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.050253 (E_RNA) where: Base-Base interactions energy: -304.104 where: short stacking energy: -140.811 Base-Backbone interact. energy: -0.505 local terms energy: -139.441048 where: bonds (distance) C4'-P energy: -25.145 bonds (distance) P-C4' energy: -26.260 flat angles C4'-P-C4' energy: -26.033 flat angles P-C4'-P energy: -18.099 tors. eta vs tors. theta energy: -43.904 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 81 Temperature: 1.050000 Total energy: -427.006276 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -427.006276 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -427.006276 (E_RNA) where: Base-Base interactions energy: -288.311 where: short stacking energy: -127.059 Base-Backbone interact. energy: -0.198 local terms energy: -138.496723 where: bonds (distance) C4'-P energy: -19.921 bonds (distance) P-C4' energy: -28.169 flat angles C4'-P-C4' energy: -27.862 flat angles P-C4'-P energy: -23.434 tors. eta vs tors. theta energy: -39.111 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 81 Temperature: 1.100000 Total energy: -393.111601 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.111601 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.111601 (E_RNA) where: Base-Base interactions energy: -262.921 where: short stacking energy: -126.757 Base-Backbone interact. energy: -0.475 local terms energy: -129.715627 where: bonds (distance) C4'-P energy: -23.092 bonds (distance) P-C4' energy: -26.752 flat angles C4'-P-C4' energy: -29.518 flat angles P-C4'-P energy: -19.728 tors. eta vs tors. theta energy: -30.626 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 81 Temperature: 1.150000 Total energy: -365.821958 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -365.821958 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -365.821958 (E_RNA) where: Base-Base interactions energy: -260.081 where: short stacking energy: -131.701 Base-Backbone interact. energy: -1.802 local terms energy: -103.939107 where: bonds (distance) C4'-P energy: -19.061 bonds (distance) P-C4' energy: -16.702 flat angles C4'-P-C4' energy: -21.314 flat angles P-C4'-P energy: -18.972 tors. eta vs tors. theta energy: -27.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 81 Temperature: 1.200000 Total energy: -284.111654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -284.111654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -284.111654 (E_RNA) where: Base-Base interactions energy: -177.094 where: short stacking energy: -101.280 Base-Backbone interact. energy: -0.000 local terms energy: -107.017009 where: bonds (distance) C4'-P energy: -16.058 bonds (distance) P-C4' energy: -24.790 flat angles C4'-P-C4' energy: -20.735 flat angles P-C4'-P energy: -18.847 tors. eta vs tors. theta energy: -26.586 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 81 Temperature: 1.250000 Total energy: -315.798721 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.798721 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.798721 (E_RNA) where: Base-Base interactions energy: -216.210 where: short stacking energy: -91.976 Base-Backbone interact. energy: -0.416 local terms energy: -99.172896 where: bonds (distance) C4'-P energy: -7.242 bonds (distance) P-C4' energy: -30.945 flat angles C4'-P-C4' energy: -19.688 flat angles P-C4'-P energy: -20.995 tors. eta vs tors. theta energy: -20.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 81 Temperature: 1.300000 Total energy: -243.002873 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -243.002873 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -243.002873 (E_RNA) where: Base-Base interactions energy: -158.764 where: short stacking energy: -75.742 Base-Backbone interact. energy: -0.801 local terms energy: -83.438129 where: bonds (distance) C4'-P energy: -24.152 bonds (distance) P-C4' energy: -21.482 flat angles C4'-P-C4' energy: -15.555 flat angles P-C4'-P energy: -13.728 tors. eta vs tors. theta energy: -8.521 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 81 Temperature: 1.350000 Total energy: -196.450679 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -196.450679 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -196.450679 (E_RNA) where: Base-Base interactions energy: -121.875 where: short stacking energy: -68.567 Base-Backbone interact. energy: -0.231 local terms energy: -74.343914 where: bonds (distance) C4'-P energy: -20.716 bonds (distance) P-C4' energy: -23.462 flat angles C4'-P-C4' energy: -13.824 flat angles P-C4'-P energy: -6.903 tors. eta vs tors. theta energy: -9.439 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 82 Temperature: 0.900000 Total energy: -465.973944 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.973944 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.973944 (E_RNA) where: Base-Base interactions energy: -325.697 where: short stacking energy: -136.773 Base-Backbone interact. energy: -0.881 local terms energy: -139.395932 where: bonds (distance) C4'-P energy: -22.992 bonds (distance) P-C4' energy: -29.012 flat angles C4'-P-C4' energy: -27.874 flat angles P-C4'-P energy: -20.086 tors. eta vs tors. theta energy: -39.432 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 82 Temperature: 0.950000 Total energy: -453.485196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.485196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.485196 (E_RNA) where: Base-Base interactions energy: -315.626 where: short stacking energy: -140.782 Base-Backbone interact. energy: -0.292 local terms energy: -137.566882 where: bonds (distance) C4'-P energy: -26.454 bonds (distance) P-C4' energy: -26.334 flat angles C4'-P-C4' energy: -25.856 flat angles P-C4'-P energy: -14.289 tors. eta vs tors. theta energy: -44.635 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 82 Temperature: 1.000000 Total energy: -429.334334 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -429.334334 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -429.334334 (E_RNA) where: Base-Base interactions energy: -292.272 where: short stacking energy: -127.203 Base-Backbone interact. energy: -0.593 local terms energy: -136.469418 where: bonds (distance) C4'-P energy: -16.395 bonds (distance) P-C4' energy: -29.262 flat angles C4'-P-C4' energy: -30.910 flat angles P-C4'-P energy: -20.558 tors. eta vs tors. theta energy: -39.344 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 82 Temperature: 1.050000 Total energy: -445.303771 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -445.303771 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -445.303771 (E_RNA) where: Base-Base interactions energy: -311.842 where: short stacking energy: -135.003 Base-Backbone interact. energy: -0.001 local terms energy: -133.460726 where: bonds (distance) C4'-P energy: -26.019 bonds (distance) P-C4' energy: -28.325 flat angles C4'-P-C4' energy: -22.681 flat angles P-C4'-P energy: -14.542 tors. eta vs tors. theta energy: -41.894 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 82 Temperature: 1.100000 Total energy: -373.513993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.513993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.513993 (E_RNA) where: Base-Base interactions energy: -254.486 where: short stacking energy: -110.523 Base-Backbone interact. energy: -0.004 local terms energy: -119.024042 where: bonds (distance) C4'-P energy: -19.880 bonds (distance) P-C4' energy: -27.278 flat angles C4'-P-C4' energy: -26.018 flat angles P-C4'-P energy: -18.694 tors. eta vs tors. theta energy: -27.153 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 82 Temperature: 1.150000 Total energy: -379.848412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -379.848412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -379.848412 (E_RNA) where: Base-Base interactions energy: -266.966 where: short stacking energy: -118.450 Base-Backbone interact. energy: -0.421 local terms energy: -112.461569 where: bonds (distance) C4'-P energy: -19.388 bonds (distance) P-C4' energy: -22.758 flat angles C4'-P-C4' energy: -25.003 flat angles P-C4'-P energy: -13.516 tors. eta vs tors. theta energy: -31.796 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 82 Temperature: 1.200000 Total energy: -343.451860 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.451860 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.451860 (E_RNA) where: Base-Base interactions energy: -228.052 where: short stacking energy: -98.372 Base-Backbone interact. energy: -1.600 local terms energy: -113.800135 where: bonds (distance) C4'-P energy: -18.542 bonds (distance) P-C4' energy: -25.480 flat angles C4'-P-C4' energy: -24.607 flat angles P-C4'-P energy: -21.114 tors. eta vs tors. theta energy: -24.057 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 82 Temperature: 1.250000 Total energy: -266.834993 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -266.834993 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -266.834993 (E_RNA) where: Base-Base interactions energy: -162.407 where: short stacking energy: -96.818 Base-Backbone interact. energy: 1.257 local terms energy: -105.685034 where: bonds (distance) C4'-P energy: -27.129 bonds (distance) P-C4' energy: -15.916 flat angles C4'-P-C4' energy: -25.555 flat angles P-C4'-P energy: -15.955 tors. eta vs tors. theta energy: -21.130 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 82 Temperature: 1.300000 Total energy: -225.498402 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -225.498402 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -225.498402 (E_RNA) where: Base-Base interactions energy: -129.108 where: short stacking energy: -72.832 Base-Backbone interact. energy: -0.497 local terms energy: -95.893508 where: bonds (distance) C4'-P energy: -20.508 bonds (distance) P-C4' energy: -23.514 flat angles C4'-P-C4' energy: -19.822 flat angles P-C4'-P energy: -14.017 tors. eta vs tors. theta energy: -18.032 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 82 Temperature: 1.350000 Total energy: -229.748593 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.748593 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.748593 (E_RNA) where: Base-Base interactions energy: -141.415 where: short stacking energy: -66.177 Base-Backbone interact. energy: -0.275 local terms energy: -88.058933 where: bonds (distance) C4'-P energy: -14.705 bonds (distance) P-C4' energy: -25.816 flat angles C4'-P-C4' energy: -21.278 flat angles P-C4'-P energy: -15.270 tors. eta vs tors. theta energy: -10.990 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 83 Temperature: 0.900000 Total energy: -462.980446 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.980446 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.980446 (E_RNA) where: Base-Base interactions energy: -325.348 where: short stacking energy: -134.726 Base-Backbone interact. energy: -0.900 local terms energy: -136.732509 where: bonds (distance) C4'-P energy: -26.803 bonds (distance) P-C4' energy: -25.270 flat angles C4'-P-C4' energy: -27.111 flat angles P-C4'-P energy: -23.391 tors. eta vs tors. theta energy: -34.158 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 83 Temperature: 0.950000 Total energy: -450.558417 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.558417 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.558417 (E_RNA) where: Base-Base interactions energy: -303.487 where: short stacking energy: -141.687 Base-Backbone interact. energy: -1.374 local terms energy: -145.697060 where: bonds (distance) C4'-P energy: -23.841 bonds (distance) P-C4' energy: -30.136 flat angles C4'-P-C4' energy: -28.839 flat angles P-C4'-P energy: -22.004 tors. eta vs tors. theta energy: -40.877 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 83 Temperature: 1.000000 Total energy: -437.735204 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -437.735204 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -437.735204 (E_RNA) where: Base-Base interactions energy: -295.560 where: short stacking energy: -132.421 Base-Backbone interact. energy: -0.825 local terms energy: -141.350351 where: bonds (distance) C4'-P energy: -20.105 bonds (distance) P-C4' energy: -28.250 flat angles C4'-P-C4' energy: -28.865 flat angles P-C4'-P energy: -22.531 tors. eta vs tors. theta energy: -41.599 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 83 Temperature: 1.050000 Total energy: -436.133109 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.133109 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.133109 (E_RNA) where: Base-Base interactions energy: -294.026 where: short stacking energy: -129.915 Base-Backbone interact. energy: -0.004 local terms energy: -142.103252 where: bonds (distance) C4'-P energy: -27.720 bonds (distance) P-C4' energy: -26.570 flat angles C4'-P-C4' energy: -28.434 flat angles P-C4'-P energy: -18.514 tors. eta vs tors. theta energy: -40.865 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 83 Temperature: 1.100000 Total energy: -363.843040 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -363.843040 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -363.843040 (E_RNA) where: Base-Base interactions energy: -247.739 where: short stacking energy: -107.775 Base-Backbone interact. energy: -0.544 local terms energy: -115.560405 where: bonds (distance) C4'-P energy: -21.317 bonds (distance) P-C4' energy: -23.076 flat angles C4'-P-C4' energy: -23.486 flat angles P-C4'-P energy: -17.685 tors. eta vs tors. theta energy: -29.996 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 83 Temperature: 1.150000 Total energy: -389.111457 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -389.111457 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -389.111457 (E_RNA) where: Base-Base interactions energy: -265.988 where: short stacking energy: -118.111 Base-Backbone interact. energy: -0.684 local terms energy: -122.439882 where: bonds (distance) C4'-P energy: -24.475 bonds (distance) P-C4' energy: -20.225 flat angles C4'-P-C4' energy: -27.326 flat angles P-C4'-P energy: -16.360 tors. eta vs tors. theta energy: -34.053 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 83 Temperature: 1.200000 Total energy: -281.935710 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -281.935710 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -281.935710 (E_RNA) where: Base-Base interactions energy: -175.624 where: short stacking energy: -83.330 Base-Backbone interact. energy: -0.625 local terms energy: -105.686931 where: bonds (distance) C4'-P energy: -25.887 bonds (distance) P-C4' energy: -23.461 flat angles C4'-P-C4' energy: -26.197 flat angles P-C4'-P energy: -15.837 tors. eta vs tors. theta energy: -14.304 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 83 Temperature: 1.250000 Total energy: -249.217629 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -249.217629 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -249.217629 (E_RNA) where: Base-Base interactions energy: -149.306 where: short stacking energy: -79.033 Base-Backbone interact. energy: 1.973 local terms energy: -101.884203 where: bonds (distance) C4'-P energy: -22.288 bonds (distance) P-C4' energy: -20.540 flat angles C4'-P-C4' energy: -27.318 flat angles P-C4'-P energy: -20.033 tors. eta vs tors. theta energy: -11.706 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 83 Temperature: 1.300000 Total energy: -246.282796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.282796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.282796 (E_RNA) where: Base-Base interactions energy: -149.028 where: short stacking energy: -80.933 Base-Backbone interact. energy: -0.208 local terms energy: -97.046635 where: bonds (distance) C4'-P energy: -12.506 bonds (distance) P-C4' energy: -23.037 flat angles C4'-P-C4' energy: -26.716 flat angles P-C4'-P energy: -16.996 tors. eta vs tors. theta energy: -17.792 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 83 Temperature: 1.350000 Total energy: -211.414538 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -211.414538 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -211.414538 (E_RNA) where: Base-Base interactions energy: -124.111 where: short stacking energy: -64.263 Base-Backbone interact. energy: -0.336 local terms energy: -86.967757 where: bonds (distance) C4'-P energy: -21.622 bonds (distance) P-C4' energy: -24.779 flat angles C4'-P-C4' energy: -16.643 flat angles P-C4'-P energy: -18.231 tors. eta vs tors. theta energy: -5.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 84 Temperature: 0.900000 Total energy: -480.020495 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -480.020495 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -480.020495 (E_RNA) where: Base-Base interactions energy: -340.452 where: short stacking energy: -143.990 Base-Backbone interact. energy: -0.125 local terms energy: -139.443247 where: bonds (distance) C4'-P energy: -22.871 bonds (distance) P-C4' energy: -27.450 flat angles C4'-P-C4' energy: -29.729 flat angles P-C4'-P energy: -20.096 tors. eta vs tors. theta energy: -39.297 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 84 Temperature: 0.950000 Total energy: -451.895063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -451.895063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -451.895063 (E_RNA) where: Base-Base interactions energy: -309.112 where: short stacking energy: -137.286 Base-Backbone interact. energy: -1.038 local terms energy: -141.745384 where: bonds (distance) C4'-P energy: -24.293 bonds (distance) P-C4' energy: -27.025 flat angles C4'-P-C4' energy: -27.979 flat angles P-C4'-P energy: -18.328 tors. eta vs tors. theta energy: -44.120 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 84 Temperature: 1.000000 Total energy: -439.120374 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.120374 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.120374 (E_RNA) where: Base-Base interactions energy: -301.184 where: short stacking energy: -138.733 Base-Backbone interact. energy: -0.034 local terms energy: -137.902214 where: bonds (distance) C4'-P energy: -23.578 bonds (distance) P-C4' energy: -25.861 flat angles C4'-P-C4' energy: -29.911 flat angles P-C4'-P energy: -20.920 tors. eta vs tors. theta energy: -37.632 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 84 Temperature: 1.050000 Total energy: -453.126069 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -453.126069 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -453.126069 (E_RNA) where: Base-Base interactions energy: -312.035 where: short stacking energy: -133.356 Base-Backbone interact. energy: -1.425 local terms energy: -139.666406 where: bonds (distance) C4'-P energy: -24.526 bonds (distance) P-C4' energy: -23.589 flat angles C4'-P-C4' energy: -30.947 flat angles P-C4'-P energy: -19.821 tors. eta vs tors. theta energy: -40.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 84 Temperature: 1.100000 Total energy: -390.991678 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.991678 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.991678 (E_RNA) where: Base-Base interactions energy: -252.723 where: short stacking energy: -125.317 Base-Backbone interact. energy: -0.141 local terms energy: -138.128125 where: bonds (distance) C4'-P energy: -24.501 bonds (distance) P-C4' energy: -27.029 flat angles C4'-P-C4' energy: -26.704 flat angles P-C4'-P energy: -25.462 tors. eta vs tors. theta energy: -34.431 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 84 Temperature: 1.150000 Total energy: -382.521251 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -382.521251 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -382.521251 (E_RNA) where: Base-Base interactions energy: -255.867 where: short stacking energy: -109.341 Base-Backbone interact. energy: -0.393 local terms energy: -126.261058 where: bonds (distance) C4'-P energy: -17.483 bonds (distance) P-C4' energy: -23.823 flat angles C4'-P-C4' energy: -28.018 flat angles P-C4'-P energy: -19.211 tors. eta vs tors. theta energy: -37.727 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 84 Temperature: 1.200000 Total energy: -262.123155 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -262.123155 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -262.123155 (E_RNA) where: Base-Base interactions energy: -164.818 where: short stacking energy: -72.844 Base-Backbone interact. energy: 0.449 local terms energy: -97.754500 where: bonds (distance) C4'-P energy: -27.502 bonds (distance) P-C4' energy: -25.064 flat angles C4'-P-C4' energy: -24.584 flat angles P-C4'-P energy: -9.714 tors. eta vs tors. theta energy: -10.891 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 84 Temperature: 1.250000 Total energy: -244.743784 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -244.743784 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -244.743784 (E_RNA) where: Base-Base interactions energy: -148.666 where: short stacking energy: -75.325 Base-Backbone interact. energy: -0.403 local terms energy: -95.674475 where: bonds (distance) C4'-P energy: -15.905 bonds (distance) P-C4' energy: -26.026 flat angles C4'-P-C4' energy: -25.846 flat angles P-C4'-P energy: -15.472 tors. eta vs tors. theta energy: -12.426 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 84 Temperature: 1.300000 Total energy: -242.821433 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -242.821433 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -242.821433 (E_RNA) where: Base-Base interactions energy: -143.988 where: short stacking energy: -75.302 Base-Backbone interact. energy: -0.101 local terms energy: -98.731984 where: bonds (distance) C4'-P energy: -20.170 bonds (distance) P-C4' energy: -27.938 flat angles C4'-P-C4' energy: -22.519 flat angles P-C4'-P energy: -14.486 tors. eta vs tors. theta energy: -13.617 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 84 Temperature: 1.350000 Total energy: -212.412035 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -212.412035 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -212.412035 (E_RNA) where: Base-Base interactions energy: -128.612 where: short stacking energy: -65.446 Base-Backbone interact. energy: -0.286 local terms energy: -83.514123 where: bonds (distance) C4'-P energy: -18.757 bonds (distance) P-C4' energy: -25.831 flat angles C4'-P-C4' energy: -20.171 flat angles P-C4'-P energy: -10.190 tors. eta vs tors. theta energy: -8.565 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 85 Temperature: 0.900000 Total energy: -474.754327 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -474.754327 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -474.754327 (E_RNA) where: Base-Base interactions energy: -334.320 where: short stacking energy: -145.159 Base-Backbone interact. energy: -1.563 local terms energy: -138.871490 where: bonds (distance) C4'-P energy: -19.994 bonds (distance) P-C4' energy: -26.207 flat angles C4'-P-C4' energy: -29.546 flat angles P-C4'-P energy: -23.478 tors. eta vs tors. theta energy: -39.646 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 85 Temperature: 0.950000 Total energy: -448.967656 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.967656 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.967656 (E_RNA) where: Base-Base interactions energy: -307.387 where: short stacking energy: -137.464 Base-Backbone interact. energy: -0.781 local terms energy: -140.799527 where: bonds (distance) C4'-P energy: -25.363 bonds (distance) P-C4' energy: -26.095 flat angles C4'-P-C4' energy: -25.619 flat angles P-C4'-P energy: -24.288 tors. eta vs tors. theta energy: -39.434 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 85 Temperature: 1.000000 Total energy: -448.294043 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.294043 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.294043 (E_RNA) where: Base-Base interactions energy: -316.511 where: short stacking energy: -136.345 Base-Backbone interact. energy: -0.800 local terms energy: -130.982493 where: bonds (distance) C4'-P energy: -17.958 bonds (distance) P-C4' energy: -23.547 flat angles C4'-P-C4' energy: -29.582 flat angles P-C4'-P energy: -21.318 tors. eta vs tors. theta energy: -38.577 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 85 Temperature: 1.050000 Total energy: -446.273479 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.273479 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.273479 (E_RNA) where: Base-Base interactions energy: -300.963 where: short stacking energy: -136.753 Base-Backbone interact. energy: -0.815 local terms energy: -144.495173 where: bonds (distance) C4'-P energy: -28.882 bonds (distance) P-C4' energy: -24.653 flat angles C4'-P-C4' energy: -26.714 flat angles P-C4'-P energy: -22.479 tors. eta vs tors. theta energy: -41.767 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 85 Temperature: 1.100000 Total energy: -385.995196 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -385.995196 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -385.995196 (E_RNA) where: Base-Base interactions energy: -263.749 where: short stacking energy: -114.832 Base-Backbone interact. energy: -0.533 local terms energy: -121.712407 where: bonds (distance) C4'-P energy: -19.181 bonds (distance) P-C4' energy: -28.346 flat angles C4'-P-C4' energy: -23.599 flat angles P-C4'-P energy: -19.067 tors. eta vs tors. theta energy: -31.519 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 85 Temperature: 1.150000 Total energy: -265.974456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -265.974456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -265.974456 (E_RNA) where: Base-Base interactions energy: -153.661 where: short stacking energy: -90.744 Base-Backbone interact. energy: 0.164 local terms energy: -112.477585 where: bonds (distance) C4'-P energy: -24.392 bonds (distance) P-C4' energy: -28.554 flat angles C4'-P-C4' energy: -21.407 flat angles P-C4'-P energy: -18.341 tors. eta vs tors. theta energy: -19.783 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 85 Temperature: 1.200000 Total energy: -395.972214 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -395.972214 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -395.972214 (E_RNA) where: Base-Base interactions energy: -274.111 where: short stacking energy: -120.302 Base-Backbone interact. energy: -0.800 local terms energy: -121.061236 where: bonds (distance) C4'-P energy: -26.412 bonds (distance) P-C4' energy: -25.134 flat angles C4'-P-C4' energy: -24.166 flat angles P-C4'-P energy: -12.342 tors. eta vs tors. theta energy: -33.007 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 85 Temperature: 1.250000 Total energy: -257.022876 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -257.022876 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -257.022876 (E_RNA) where: Base-Base interactions energy: -156.715 where: short stacking energy: -86.590 Base-Backbone interact. energy: 0.332 local terms energy: -100.639932 where: bonds (distance) C4'-P energy: -15.755 bonds (distance) P-C4' energy: -22.802 flat angles C4'-P-C4' energy: -26.639 flat angles P-C4'-P energy: -14.974 tors. eta vs tors. theta energy: -20.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 85 Temperature: 1.300000 Total energy: -213.404263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.404263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.404263 (E_RNA) where: Base-Base interactions energy: -127.494 where: short stacking energy: -57.340 Base-Backbone interact. energy: -0.070 local terms energy: -85.840356 where: bonds (distance) C4'-P energy: -22.429 bonds (distance) P-C4' energy: -23.819 flat angles C4'-P-C4' energy: -23.087 flat angles P-C4'-P energy: -13.636 tors. eta vs tors. theta energy: -2.869 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 85 Temperature: 1.350000 Total energy: -224.501517 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.501517 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.501517 (E_RNA) where: Base-Base interactions energy: -130.659 where: short stacking energy: -75.904 Base-Backbone interact. energy: 0.198 local terms energy: -94.041080 where: bonds (distance) C4'-P energy: -27.343 bonds (distance) P-C4' energy: -21.071 flat angles C4'-P-C4' energy: -20.462 flat angles P-C4'-P energy: -11.782 tors. eta vs tors. theta energy: -13.383 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 86 Temperature: 0.900000 Total energy: -467.356350 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.356350 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.356350 (E_RNA) where: Base-Base interactions energy: -320.624 where: short stacking energy: -130.446 Base-Backbone interact. energy: -1.141 local terms energy: -145.590938 where: bonds (distance) C4'-P energy: -29.509 bonds (distance) P-C4' energy: -25.551 flat angles C4'-P-C4' energy: -28.371 flat angles P-C4'-P energy: -21.519 tors. eta vs tors. theta energy: -40.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 86 Temperature: 0.950000 Total energy: -459.095654 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.095654 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.095654 (E_RNA) where: Base-Base interactions energy: -315.650 where: short stacking energy: -147.526 Base-Backbone interact. energy: -0.036 local terms energy: -143.410033 where: bonds (distance) C4'-P energy: -21.605 bonds (distance) P-C4' energy: -25.601 flat angles C4'-P-C4' energy: -28.979 flat angles P-C4'-P energy: -23.606 tors. eta vs tors. theta energy: -43.619 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 86 Temperature: 1.000000 Total energy: -436.631640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -436.631640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -436.631640 (E_RNA) where: Base-Base interactions energy: -306.410 where: short stacking energy: -138.311 Base-Backbone interact. energy: -0.163 local terms energy: -130.058609 where: bonds (distance) C4'-P energy: -21.349 bonds (distance) P-C4' energy: -26.373 flat angles C4'-P-C4' energy: -26.281 flat angles P-C4'-P energy: -14.465 tors. eta vs tors. theta energy: -41.590 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 86 Temperature: 1.050000 Total energy: -438.590253 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.590253 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.590253 (E_RNA) where: Base-Base interactions energy: -292.581 where: short stacking energy: -128.848 Base-Backbone interact. energy: -0.586 local terms energy: -145.423272 where: bonds (distance) C4'-P energy: -26.856 bonds (distance) P-C4' energy: -30.142 flat angles C4'-P-C4' energy: -28.943 flat angles P-C4'-P energy: -19.799 tors. eta vs tors. theta energy: -39.683 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 86 Temperature: 1.100000 Total energy: -378.112894 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.112894 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.112894 (E_RNA) where: Base-Base interactions energy: -249.237 where: short stacking energy: -113.282 Base-Backbone interact. energy: -0.010 local terms energy: -128.865113 where: bonds (distance) C4'-P energy: -21.155 bonds (distance) P-C4' energy: -23.877 flat angles C4'-P-C4' energy: -29.859 flat angles P-C4'-P energy: -23.374 tors. eta vs tors. theta energy: -30.600 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 8 ===================================== Write number: 86 Temperature: 1.150000 Total energy: -282.670796 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.670796 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.670796 (E_RNA) where: Base-Base interactions energy: -181.241 where: short stacking energy: -90.941 Base-Backbone interact. energy: -0.379 local terms energy: -101.050673 where: bonds (distance) C4'-P energy: -24.171 bonds (distance) P-C4' energy: -24.556 flat angles C4'-P-C4' energy: -16.815 flat angles P-C4'-P energy: -12.779 tors. eta vs tors. theta energy: -22.729 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 3 ===================================== Write number: 86 Temperature: 1.200000 Total energy: -377.995970 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -377.995970 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -377.995970 (E_RNA) where: Base-Base interactions energy: -262.656 where: short stacking energy: -112.590 Base-Backbone interact. energy: 1.188 local terms energy: -116.528531 where: bonds (distance) C4'-P energy: -21.187 bonds (distance) P-C4' energy: -27.005 flat angles C4'-P-C4' energy: -21.513 flat angles P-C4'-P energy: -17.799 tors. eta vs tors. theta energy: -29.024 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 86 Temperature: 1.250000 Total energy: -232.732900 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.732900 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.732900 (E_RNA) where: Base-Base interactions energy: -141.800 where: short stacking energy: -68.155 Base-Backbone interact. energy: -0.536 local terms energy: -90.396462 where: bonds (distance) C4'-P energy: -15.795 bonds (distance) P-C4' energy: -29.577 flat angles C4'-P-C4' energy: -16.382 flat angles P-C4'-P energy: -17.075 tors. eta vs tors. theta energy: -11.568 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 86 Temperature: 1.300000 Total energy: -223.005783 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.005783 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.005783 (E_RNA) where: Base-Base interactions energy: -137.362 where: short stacking energy: -65.642 Base-Backbone interact. energy: 0.675 local terms energy: -86.318414 where: bonds (distance) C4'-P energy: -24.517 bonds (distance) P-C4' energy: -23.042 flat angles C4'-P-C4' energy: -20.706 flat angles P-C4'-P energy: -12.227 tors. eta vs tors. theta energy: -5.826 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 86 Temperature: 1.350000 Total energy: -232.472068 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.472068 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.472068 (E_RNA) where: Base-Base interactions energy: -133.947 where: short stacking energy: -68.423 Base-Backbone interact. energy: -0.198 local terms energy: -98.327207 where: bonds (distance) C4'-P energy: -24.993 bonds (distance) P-C4' energy: -28.594 flat angles C4'-P-C4' energy: -23.729 flat angles P-C4'-P energy: -7.308 tors. eta vs tors. theta energy: -13.703 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 2 ===================================== Write number: 87 Temperature: 0.900000 Total energy: -465.787736 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.787736 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.787736 (E_RNA) where: Base-Base interactions energy: -322.116 where: short stacking energy: -137.419 Base-Backbone interact. energy: -0.266 local terms energy: -143.405504 where: bonds (distance) C4'-P energy: -25.448 bonds (distance) P-C4' energy: -26.874 flat angles C4'-P-C4' energy: -30.125 flat angles P-C4'-P energy: -19.508 tors. eta vs tors. theta energy: -41.451 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 87 Temperature: 0.950000 Total energy: -460.839610 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.839610 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.839610 (E_RNA) where: Base-Base interactions energy: -323.809 where: short stacking energy: -142.869 Base-Backbone interact. energy: -0.005 local terms energy: -137.025507 where: bonds (distance) C4'-P energy: -30.288 bonds (distance) P-C4' energy: -23.562 flat angles C4'-P-C4' energy: -26.084 flat angles P-C4'-P energy: -20.741 tors. eta vs tors. theta energy: -36.350 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 87 Temperature: 1.000000 Total energy: -449.662549 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -449.662549 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -449.662549 (E_RNA) where: Base-Base interactions energy: -306.578 where: short stacking energy: -140.637 Base-Backbone interact. energy: 0.332 local terms energy: -143.416290 where: bonds (distance) C4'-P energy: -24.327 bonds (distance) P-C4' energy: -25.005 flat angles C4'-P-C4' energy: -27.874 flat angles P-C4'-P energy: -24.168 tors. eta vs tors. theta energy: -42.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 4 ===================================== Write number: 87 Temperature: 1.050000 Total energy: -433.633891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.633891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.633891 (E_RNA) where: Base-Base interactions energy: -304.864 where: short stacking energy: -140.089 Base-Backbone interact. energy: 2.343 local terms energy: -131.112716 where: bonds (distance) C4'-P energy: -23.662 bonds (distance) P-C4' energy: -24.359 flat angles C4'-P-C4' energy: -26.606 flat angles P-C4'-P energy: -16.746 tors. eta vs tors. theta energy: -39.740 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 87 Temperature: 1.100000 Total energy: -375.903412 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -375.903412 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -375.903412 (E_RNA) where: Base-Base interactions energy: -260.432 where: short stacking energy: -110.764 Base-Backbone interact. energy: 0.002 local terms energy: -115.473397 where: bonds (distance) C4'-P energy: -16.758 bonds (distance) P-C4' energy: -24.283 flat angles C4'-P-C4' energy: -24.318 flat angles P-C4'-P energy: -19.178 tors. eta vs tors. theta energy: -30.937 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 87 Temperature: 1.150000 Total energy: -393.877225 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -393.877225 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -393.877225 (E_RNA) where: Base-Base interactions energy: -269.073 where: short stacking energy: -125.941 Base-Backbone interact. energy: -0.928 local terms energy: -123.875369 where: bonds (distance) C4'-P energy: -21.349 bonds (distance) P-C4' energy: -25.485 flat angles C4'-P-C4' energy: -27.361 flat angles P-C4'-P energy: -15.018 tors. eta vs tors. theta energy: -34.661 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 87 Temperature: 1.200000 Total energy: -282.817731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -282.817731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -282.817731 (E_RNA) where: Base-Base interactions energy: -184.597 where: short stacking energy: -84.461 Base-Backbone interact. energy: -0.382 local terms energy: -97.839250 where: bonds (distance) C4'-P energy: -19.765 bonds (distance) P-C4' energy: -18.044 flat angles C4'-P-C4' energy: -19.666 flat angles P-C4'-P energy: -18.007 tors. eta vs tors. theta energy: -22.357 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 87 Temperature: 1.250000 Total energy: -215.092800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -215.092800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -215.092800 (E_RNA) where: Base-Base interactions energy: -125.574 where: short stacking energy: -70.876 Base-Backbone interact. energy: -0.140 local terms energy: -89.378664 where: bonds (distance) C4'-P energy: -20.349 bonds (distance) P-C4' energy: -23.606 flat angles C4'-P-C4' energy: -23.480 flat angles P-C4'-P energy: -14.576 tors. eta vs tors. theta energy: -7.368 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 87 Temperature: 1.300000 Total energy: -223.366456 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.366456 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.366456 (E_RNA) where: Base-Base interactions energy: -129.926 where: short stacking energy: -74.420 Base-Backbone interact. energy: -0.565 local terms energy: -92.875133 where: bonds (distance) C4'-P energy: -17.932 bonds (distance) P-C4' energy: -22.105 flat angles C4'-P-C4' energy: -26.296 flat angles P-C4'-P energy: -11.024 tors. eta vs tors. theta energy: -15.518 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 87 Temperature: 1.350000 Total energy: -208.014715 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.014715 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.014715 (E_RNA) where: Base-Base interactions energy: -118.846 where: short stacking energy: -71.133 Base-Backbone interact. energy: -0.004 local terms energy: -89.163792 where: bonds (distance) C4'-P energy: -24.053 bonds (distance) P-C4' energy: -25.199 flat angles C4'-P-C4' energy: -22.109 flat angles P-C4'-P energy: -9.264 tors. eta vs tors. theta energy: -8.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 88 Temperature: 0.900000 Total energy: -465.674216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.674216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.674216 (E_RNA) where: Base-Base interactions energy: -317.167 where: short stacking energy: -135.513 Base-Backbone interact. energy: -0.358 local terms energy: -148.148968 where: bonds (distance) C4'-P energy: -28.614 bonds (distance) P-C4' energy: -29.463 flat angles C4'-P-C4' energy: -30.063 flat angles P-C4'-P energy: -23.651 tors. eta vs tors. theta energy: -36.358 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 2 ===================================== Write number: 88 Temperature: 0.950000 Total energy: -459.720488 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -459.720488 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -459.720488 (E_RNA) where: Base-Base interactions energy: -318.192 where: short stacking energy: -135.282 Base-Backbone interact. energy: -1.720 local terms energy: -139.808342 where: bonds (distance) C4'-P energy: -23.149 bonds (distance) P-C4' energy: -29.435 flat angles C4'-P-C4' energy: -30.486 flat angles P-C4'-P energy: -17.077 tors. eta vs tors. theta energy: -39.662 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 4 ===================================== Write number: 88 Temperature: 1.000000 Total energy: -448.726857 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.726857 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.726857 (E_RNA) where: Base-Base interactions energy: -301.901 where: short stacking energy: -143.303 Base-Backbone interact. energy: -0.956 local terms energy: -145.870379 where: bonds (distance) C4'-P energy: -25.367 bonds (distance) P-C4' energy: -26.486 flat angles C4'-P-C4' energy: -30.234 flat angles P-C4'-P energy: -22.198 tors. eta vs tors. theta energy: -41.584 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 88 Temperature: 1.050000 Total energy: -442.674194 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -442.674194 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -442.674194 (E_RNA) where: Base-Base interactions energy: -302.281 where: short stacking energy: -137.684 Base-Backbone interact. energy: -0.078 local terms energy: -140.315185 where: bonds (distance) C4'-P energy: -23.456 bonds (distance) P-C4' energy: -23.009 flat angles C4'-P-C4' energy: -31.310 flat angles P-C4'-P energy: -22.505 tors. eta vs tors. theta energy: -40.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 88 Temperature: 1.100000 Total energy: -410.634450 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -410.634450 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -410.634450 (E_RNA) where: Base-Base interactions energy: -282.651 where: short stacking energy: -127.642 Base-Backbone interact. energy: -1.087 local terms energy: -126.896791 where: bonds (distance) C4'-P energy: -26.836 bonds (distance) P-C4' energy: -19.967 flat angles C4'-P-C4' energy: -28.622 flat angles P-C4'-P energy: -19.025 tors. eta vs tors. theta energy: -32.447 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 88 Temperature: 1.150000 Total energy: -362.460144 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -362.460144 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -362.460144 (E_RNA) where: Base-Base interactions energy: -246.395 where: short stacking energy: -115.351 Base-Backbone interact. energy: -0.729 local terms energy: -115.336085 where: bonds (distance) C4'-P energy: -20.479 bonds (distance) P-C4' energy: -22.750 flat angles C4'-P-C4' energy: -25.865 flat angles P-C4'-P energy: -14.418 tors. eta vs tors. theta energy: -31.823 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 88 Temperature: 1.200000 Total energy: -292.269725 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.269725 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.269725 (E_RNA) where: Base-Base interactions energy: -184.688 where: short stacking energy: -90.795 Base-Backbone interact. energy: -1.115 local terms energy: -106.466740 where: bonds (distance) C4'-P energy: -20.722 bonds (distance) P-C4' energy: -26.652 flat angles C4'-P-C4' energy: -25.646 flat angles P-C4'-P energy: -12.641 tors. eta vs tors. theta energy: -20.805 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 88 Temperature: 1.250000 Total energy: -231.640474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -231.640474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -231.640474 (E_RNA) where: Base-Base interactions energy: -135.455 where: short stacking energy: -76.070 Base-Backbone interact. energy: 1.846 local terms energy: -98.031446 where: bonds (distance) C4'-P energy: -16.716 bonds (distance) P-C4' energy: -24.613 flat angles C4'-P-C4' energy: -23.369 flat angles P-C4'-P energy: -17.597 tors. eta vs tors. theta energy: -15.736 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 88 Temperature: 1.300000 Total energy: -279.278515 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -279.278515 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -279.278515 (E_RNA) where: Base-Base interactions energy: -179.035 where: short stacking energy: -85.591 Base-Backbone interact. energy: -1.553 local terms energy: -98.691034 where: bonds (distance) C4'-P energy: -16.471 bonds (distance) P-C4' energy: -20.574 flat angles C4'-P-C4' energy: -29.920 flat angles P-C4'-P energy: -16.095 tors. eta vs tors. theta energy: -15.631 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 88 Temperature: 1.350000 Total energy: -208.903789 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -208.903789 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -208.903789 (E_RNA) where: Base-Base interactions energy: -121.743 where: short stacking energy: -57.614 Base-Backbone interact. energy: -0.194 local terms energy: -86.967153 where: bonds (distance) C4'-P energy: -18.812 bonds (distance) P-C4' energy: -24.589 flat angles C4'-P-C4' energy: -21.440 flat angles P-C4'-P energy: -16.493 tors. eta vs tors. theta energy: -5.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 89 Temperature: 0.900000 Total energy: -468.897344 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -468.897344 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -468.897344 (E_RNA) where: Base-Base interactions energy: -322.448 where: short stacking energy: -158.289 Base-Backbone interact. energy: -0.934 local terms energy: -145.515694 where: bonds (distance) C4'-P energy: -29.153 bonds (distance) P-C4' energy: -27.028 flat angles C4'-P-C4' energy: -27.981 flat angles P-C4'-P energy: -17.222 tors. eta vs tors. theta energy: -44.131 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 89 Temperature: 0.950000 Total energy: -454.341303 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.341303 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.341303 (E_RNA) where: Base-Base interactions energy: -312.005 where: short stacking energy: -147.825 Base-Backbone interact. energy: -0.071 local terms energy: -142.266258 where: bonds (distance) C4'-P energy: -23.147 bonds (distance) P-C4' energy: -23.840 flat angles C4'-P-C4' energy: -30.816 flat angles P-C4'-P energy: -23.622 tors. eta vs tors. theta energy: -40.841 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 89 Temperature: 1.000000 Total energy: -455.851760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.851760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.851760 (E_RNA) where: Base-Base interactions energy: -316.859 where: short stacking energy: -128.280 Base-Backbone interact. energy: 0.587 local terms energy: -139.579353 where: bonds (distance) C4'-P energy: -29.518 bonds (distance) P-C4' energy: -28.201 flat angles C4'-P-C4' energy: -26.843 flat angles P-C4'-P energy: -20.239 tors. eta vs tors. theta energy: -34.779 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 7 ===================================== Write number: 89 Temperature: 1.050000 Total energy: -438.839643 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -438.839643 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -438.839643 (E_RNA) where: Base-Base interactions energy: -299.542 where: short stacking energy: -122.418 Base-Backbone interact. energy: -0.392 local terms energy: -138.905516 where: bonds (distance) C4'-P energy: -27.498 bonds (distance) P-C4' energy: -26.331 flat angles C4'-P-C4' energy: -26.449 flat angles P-C4'-P energy: -18.285 tors. eta vs tors. theta energy: -40.343 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 89 Temperature: 1.100000 Total energy: -407.633333 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.633333 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.633333 (E_RNA) where: Base-Base interactions energy: -273.557 where: short stacking energy: -130.414 Base-Backbone interact. energy: -1.118 local terms energy: -132.958877 where: bonds (distance) C4'-P energy: -25.518 bonds (distance) P-C4' energy: -24.431 flat angles C4'-P-C4' energy: -25.536 flat angles P-C4'-P energy: -22.934 tors. eta vs tors. theta energy: -34.539 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 89 Temperature: 1.150000 Total energy: -364.527650 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -364.527650 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -364.527650 (E_RNA) where: Base-Base interactions energy: -242.267 where: short stacking energy: -110.209 Base-Backbone interact. energy: -0.356 local terms energy: -121.905190 where: bonds (distance) C4'-P energy: -26.847 bonds (distance) P-C4' energy: -24.633 flat angles C4'-P-C4' energy: -29.835 flat angles P-C4'-P energy: -11.881 tors. eta vs tors. theta energy: -28.708 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 89 Temperature: 1.200000 Total energy: -291.350974 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -291.350974 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -291.350974 (E_RNA) where: Base-Base interactions energy: -192.775 where: short stacking energy: -95.652 Base-Backbone interact. energy: 0.626 local terms energy: -99.202166 where: bonds (distance) C4'-P energy: -11.921 bonds (distance) P-C4' energy: -24.834 flat angles C4'-P-C4' energy: -24.920 flat angles P-C4'-P energy: -17.596 tors. eta vs tors. theta energy: -19.931 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 89 Temperature: 1.250000 Total energy: -305.548030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.548030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.548030 (E_RNA) where: Base-Base interactions energy: -203.233 where: short stacking energy: -88.661 Base-Backbone interact. energy: -1.758 local terms energy: -100.557024 where: bonds (distance) C4'-P energy: -21.266 bonds (distance) P-C4' energy: -21.339 flat angles C4'-P-C4' energy: -25.721 flat angles P-C4'-P energy: -18.544 tors. eta vs tors. theta energy: -13.686 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 89 Temperature: 1.300000 Total energy: -217.742718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -217.742718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -217.742718 (E_RNA) where: Base-Base interactions energy: -125.887 where: short stacking energy: -68.206 Base-Backbone interact. energy: 0.371 local terms energy: -92.227040 where: bonds (distance) C4'-P energy: -20.899 bonds (distance) P-C4' energy: -22.317 flat angles C4'-P-C4' energy: -27.118 flat angles P-C4'-P energy: -16.446 tors. eta vs tors. theta energy: -5.448 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 89 Temperature: 1.350000 Total energy: -214.768154 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.768154 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.768154 (E_RNA) where: Base-Base interactions energy: -115.016 where: short stacking energy: -63.124 Base-Backbone interact. energy: -0.115 local terms energy: -99.637419 where: bonds (distance) C4'-P energy: -26.454 bonds (distance) P-C4' energy: -26.024 flat angles C4'-P-C4' energy: -17.358 flat angles P-C4'-P energy: -17.210 tors. eta vs tors. theta energy: -12.591 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 90 Temperature: 0.900000 Total energy: -460.907001 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.907001 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.907001 (E_RNA) where: Base-Base interactions energy: -317.326 where: short stacking energy: -147.504 Base-Backbone interact. energy: -1.162 local terms energy: -142.418966 where: bonds (distance) C4'-P energy: -20.517 bonds (distance) P-C4' energy: -26.279 flat angles C4'-P-C4' energy: -31.749 flat angles P-C4'-P energy: -18.264 tors. eta vs tors. theta energy: -45.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 90 Temperature: 0.950000 Total energy: -460.059605 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.059605 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.059605 (E_RNA) where: Base-Base interactions energy: -319.128 where: short stacking energy: -131.156 Base-Backbone interact. energy: -0.721 local terms energy: -140.210566 where: bonds (distance) C4'-P energy: -30.835 bonds (distance) P-C4' energy: -26.612 flat angles C4'-P-C4' energy: -25.680 flat angles P-C4'-P energy: -19.370 tors. eta vs tors. theta energy: -37.714 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 90 Temperature: 1.000000 Total energy: -433.766718 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.766718 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.766718 (E_RNA) where: Base-Base interactions energy: -290.669 where: short stacking energy: -133.885 Base-Backbone interact. energy: -0.583 local terms energy: -142.515153 where: bonds (distance) C4'-P energy: -26.268 bonds (distance) P-C4' energy: -30.116 flat angles C4'-P-C4' energy: -22.017 flat angles P-C4'-P energy: -22.674 tors. eta vs tors. theta energy: -41.440 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 90 Temperature: 1.050000 Total energy: -441.587228 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.587228 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.587228 (E_RNA) where: Base-Base interactions energy: -315.601 where: short stacking energy: -134.809 Base-Backbone interact. energy: 1.407 local terms energy: -127.393322 where: bonds (distance) C4'-P energy: -20.681 bonds (distance) P-C4' energy: -23.714 flat angles C4'-P-C4' energy: -24.515 flat angles P-C4'-P energy: -20.741 tors. eta vs tors. theta energy: -37.742 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 90 Temperature: 1.100000 Total energy: -412.662028 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -412.662028 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -412.662028 (E_RNA) where: Base-Base interactions energy: -286.011 where: short stacking energy: -135.364 Base-Backbone interact. energy: 0.198 local terms energy: -126.848715 where: bonds (distance) C4'-P energy: -17.999 bonds (distance) P-C4' energy: -24.330 flat angles C4'-P-C4' energy: -27.992 flat angles P-C4'-P energy: -19.949 tors. eta vs tors. theta energy: -36.578 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 90 Temperature: 1.150000 Total energy: -346.114984 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -346.114984 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -346.114984 (E_RNA) where: Base-Base interactions energy: -236.468 where: short stacking energy: -97.704 Base-Backbone interact. energy: -0.345 local terms energy: -109.301892 where: bonds (distance) C4'-P energy: -19.392 bonds (distance) P-C4' energy: -26.241 flat angles C4'-P-C4' energy: -21.737 flat angles P-C4'-P energy: -18.285 tors. eta vs tors. theta energy: -23.647 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 90 Temperature: 1.200000 Total energy: -302.853712 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -302.853712 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -302.853712 (E_RNA) where: Base-Base interactions energy: -190.920 where: short stacking energy: -93.133 Base-Backbone interact. energy: 1.331 local terms energy: -113.265299 where: bonds (distance) C4'-P energy: -20.888 bonds (distance) P-C4' energy: -27.221 flat angles C4'-P-C4' energy: -23.430 flat angles P-C4'-P energy: -19.765 tors. eta vs tors. theta energy: -21.962 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 90 Temperature: 1.250000 Total energy: -337.461000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -337.461000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -337.461000 (E_RNA) where: Base-Base interactions energy: -224.834 where: short stacking energy: -92.595 Base-Backbone interact. energy: -1.325 local terms energy: -111.302572 where: bonds (distance) C4'-P energy: -21.408 bonds (distance) P-C4' energy: -23.480 flat angles C4'-P-C4' energy: -24.453 flat angles P-C4'-P energy: -19.980 tors. eta vs tors. theta energy: -21.981 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 90 Temperature: 1.300000 Total energy: -240.544913 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -240.544913 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -240.544913 (E_RNA) where: Base-Base interactions energy: -152.164 where: short stacking energy: -77.426 Base-Backbone interact. energy: 0.600 local terms energy: -88.981129 where: bonds (distance) C4'-P energy: -20.526 bonds (distance) P-C4' energy: -26.465 flat angles C4'-P-C4' energy: -20.876 flat angles P-C4'-P energy: -9.732 tors. eta vs tors. theta energy: -11.382 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 90 Temperature: 1.350000 Total energy: -199.028088 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -199.028088 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -199.028088 (E_RNA) where: Base-Base interactions energy: -124.008 where: short stacking energy: -59.857 Base-Backbone interact. energy: -0.660 local terms energy: -74.360250 where: bonds (distance) C4'-P energy: -20.218 bonds (distance) P-C4' energy: -23.188 flat angles C4'-P-C4' energy: -11.236 flat angles P-C4'-P energy: -14.192 tors. eta vs tors. theta energy: -5.527 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 1 ===================================== Write number: 91 Temperature: 0.900000 Total energy: -462.536964 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.536964 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.536964 (E_RNA) where: Base-Base interactions energy: -318.162 where: short stacking energy: -142.378 Base-Backbone interact. energy: -1.838 local terms energy: -142.537170 where: bonds (distance) C4'-P energy: -26.070 bonds (distance) P-C4' energy: -29.548 flat angles C4'-P-C4' energy: -29.824 flat angles P-C4'-P energy: -18.375 tors. eta vs tors. theta energy: -38.721 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 91 Temperature: 0.950000 Total energy: -460.362306 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -460.362306 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -460.362306 (E_RNA) where: Base-Base interactions energy: -314.901 where: short stacking energy: -143.005 Base-Backbone interact. energy: 0.718 local terms energy: -146.179412 where: bonds (distance) C4'-P energy: -27.386 bonds (distance) P-C4' energy: -20.417 flat angles C4'-P-C4' energy: -29.949 flat angles P-C4'-P energy: -22.173 tors. eta vs tors. theta energy: -46.255 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 91 Temperature: 1.000000 Total energy: -440.683793 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -440.683793 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -440.683793 (E_RNA) where: Base-Base interactions energy: -298.479 where: short stacking energy: -122.415 Base-Backbone interact. energy: -0.034 local terms energy: -142.170956 where: bonds (distance) C4'-P energy: -28.120 bonds (distance) P-C4' energy: -28.789 flat angles C4'-P-C4' energy: -26.496 flat angles P-C4'-P energy: -19.016 tors. eta vs tors. theta energy: -39.749 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 91 Temperature: 1.050000 Total energy: -424.094313 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -424.094313 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -424.094313 (E_RNA) where: Base-Base interactions energy: -296.286 where: short stacking energy: -126.345 Base-Backbone interact. energy: -0.155 local terms energy: -127.653991 where: bonds (distance) C4'-P energy: -28.479 bonds (distance) P-C4' energy: -24.947 flat angles C4'-P-C4' energy: -25.188 flat angles P-C4'-P energy: -14.222 tors. eta vs tors. theta energy: -34.818 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 91 Temperature: 1.100000 Total energy: -432.180090 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.180090 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.180090 (E_RNA) where: Base-Base interactions energy: -303.530 where: short stacking energy: -134.196 Base-Backbone interact. energy: -0.505 local terms energy: -128.144350 where: bonds (distance) C4'-P energy: -22.524 bonds (distance) P-C4' energy: -21.309 flat angles C4'-P-C4' energy: -26.700 flat angles P-C4'-P energy: -21.383 tors. eta vs tors. theta energy: -36.229 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 91 Temperature: 1.150000 Total energy: -352.808859 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.808859 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.808859 (E_RNA) where: Base-Base interactions energy: -238.770 where: short stacking energy: -111.582 Base-Backbone interact. energy: -1.427 local terms energy: -112.611537 where: bonds (distance) C4'-P energy: -25.563 bonds (distance) P-C4' energy: -26.597 flat angles C4'-P-C4' energy: -24.775 flat angles P-C4'-P energy: -12.706 tors. eta vs tors. theta energy: -22.971 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 91 Temperature: 1.200000 Total energy: -296.461930 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -296.461930 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -296.461930 (E_RNA) where: Base-Base interactions energy: -189.110 where: short stacking energy: -95.839 Base-Backbone interact. energy: -0.770 local terms energy: -106.581569 where: bonds (distance) C4'-P energy: -19.326 bonds (distance) P-C4' energy: -19.997 flat angles C4'-P-C4' energy: -29.722 flat angles P-C4'-P energy: -13.117 tors. eta vs tors. theta energy: -24.420 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 91 Temperature: 1.250000 Total energy: -293.265218 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -293.265218 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -293.265218 (E_RNA) where: Base-Base interactions energy: -187.438 where: short stacking energy: -82.028 Base-Backbone interact. energy: -0.990 local terms energy: -104.837611 where: bonds (distance) C4'-P energy: -24.998 bonds (distance) P-C4' energy: -26.710 flat angles C4'-P-C4' energy: -23.931 flat angles P-C4'-P energy: -11.812 tors. eta vs tors. theta energy: -17.387 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 91 Temperature: 1.300000 Total energy: -228.671211 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.671211 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.671211 (E_RNA) where: Base-Base interactions energy: -135.559 where: short stacking energy: -74.752 Base-Backbone interact. energy: -0.667 local terms energy: -92.445717 where: bonds (distance) C4'-P energy: -20.337 bonds (distance) P-C4' energy: -26.765 flat angles C4'-P-C4' energy: -18.762 flat angles P-C4'-P energy: -11.081 tors. eta vs tors. theta energy: -15.500 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 91 Temperature: 1.350000 Total energy: -222.259208 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.259208 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.259208 (E_RNA) where: Base-Base interactions energy: -130.271 where: short stacking energy: -68.435 Base-Backbone interact. energy: 1.272 local terms energy: -93.260914 where: bonds (distance) C4'-P energy: -24.466 bonds (distance) P-C4' energy: -23.278 flat angles C4'-P-C4' energy: -19.077 flat angles P-C4'-P energy: -10.520 tors. eta vs tors. theta energy: -15.920 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 92 Temperature: 0.900000 Total energy: -470.088502 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -470.088502 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -470.088502 (E_RNA) where: Base-Base interactions energy: -316.616 where: short stacking energy: -146.401 Base-Backbone interact. energy: -1.484 local terms energy: -151.987960 where: bonds (distance) C4'-P energy: -29.891 bonds (distance) P-C4' energy: -30.154 flat angles C4'-P-C4' energy: -29.193 flat angles P-C4'-P energy: -22.729 tors. eta vs tors. theta energy: -40.022 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 1 ===================================== Write number: 92 Temperature: 0.950000 Total energy: -457.171201 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.171201 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.171201 (E_RNA) where: Base-Base interactions energy: -316.402 where: short stacking energy: -147.754 Base-Backbone interact. energy: -0.595 local terms energy: -140.174361 where: bonds (distance) C4'-P energy: -25.661 bonds (distance) P-C4' energy: -26.666 flat angles C4'-P-C4' energy: -28.969 flat angles P-C4'-P energy: -15.575 tors. eta vs tors. theta energy: -43.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 7 ===================================== Write number: 92 Temperature: 1.000000 Total energy: -457.539696 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.539696 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.539696 (E_RNA) where: Base-Base interactions energy: -320.271 where: short stacking energy: -144.087 Base-Backbone interact. energy: -0.014 local terms energy: -137.254635 where: bonds (distance) C4'-P energy: -28.302 bonds (distance) P-C4' energy: -21.010 flat angles C4'-P-C4' energy: -29.808 flat angles P-C4'-P energy: -16.988 tors. eta vs tors. theta energy: -41.146 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 3 ===================================== Write number: 92 Temperature: 1.050000 Total energy: -413.567767 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.567767 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.567767 (E_RNA) where: Base-Base interactions energy: -281.689 where: short stacking energy: -125.451 Base-Backbone interact. energy: -0.341 local terms energy: -131.537635 where: bonds (distance) C4'-P energy: -26.794 bonds (distance) P-C4' energy: -25.408 flat angles C4'-P-C4' energy: -30.104 flat angles P-C4'-P energy: -18.513 tors. eta vs tors. theta energy: -30.719 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 2 ===================================== Write number: 92 Temperature: 1.100000 Total energy: -441.854614 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -441.854614 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -441.854614 (E_RNA) where: Base-Base interactions energy: -308.257 where: short stacking energy: -131.459 Base-Backbone interact. energy: -1.400 local terms energy: -132.197896 where: bonds (distance) C4'-P energy: -21.358 bonds (distance) P-C4' energy: -23.322 flat angles C4'-P-C4' energy: -29.343 flat angles P-C4'-P energy: -20.683 tors. eta vs tors. theta energy: -37.491 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 92 Temperature: 1.150000 Total energy: -352.792575 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -352.792575 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -352.792575 (E_RNA) where: Base-Base interactions energy: -231.184 where: short stacking energy: -101.808 Base-Backbone interact. energy: -0.697 local terms energy: -120.911541 where: bonds (distance) C4'-P energy: -25.682 bonds (distance) P-C4' energy: -27.221 flat angles C4'-P-C4' energy: -26.740 flat angles P-C4'-P energy: -16.174 tors. eta vs tors. theta energy: -25.095 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 92 Temperature: 1.200000 Total energy: -287.927354 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -287.927354 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -287.927354 (E_RNA) where: Base-Base interactions energy: -185.499 where: short stacking energy: -80.105 Base-Backbone interact. energy: 0.217 local terms energy: -102.645511 where: bonds (distance) C4'-P energy: -28.896 bonds (distance) P-C4' energy: -21.216 flat angles C4'-P-C4' energy: -20.488 flat angles P-C4'-P energy: -16.568 tors. eta vs tors. theta energy: -15.477 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 92 Temperature: 1.250000 Total energy: -288.768063 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -288.768063 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -288.768063 (E_RNA) where: Base-Base interactions energy: -193.016 where: short stacking energy: -100.051 Base-Backbone interact. energy: -1.582 local terms energy: -94.170606 where: bonds (distance) C4'-P energy: -17.845 bonds (distance) P-C4' energy: -20.755 flat angles C4'-P-C4' energy: -17.101 flat angles P-C4'-P energy: -15.158 tors. eta vs tors. theta energy: -23.312 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 92 Temperature: 1.300000 Total energy: -223.504778 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.504778 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.504778 (E_RNA) where: Base-Base interactions energy: -130.262 where: short stacking energy: -62.606 Base-Backbone interact. energy: -0.813 local terms energy: -92.429899 where: bonds (distance) C4'-P energy: -28.233 bonds (distance) P-C4' energy: -29.182 flat angles C4'-P-C4' energy: -17.494 flat angles P-C4'-P energy: -12.317 tors. eta vs tors. theta energy: -5.204 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 92 Temperature: 1.350000 Total energy: -228.665626 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.665626 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.665626 (E_RNA) where: Base-Base interactions energy: -137.982 where: short stacking energy: -73.876 Base-Backbone interact. energy: -0.360 local terms energy: -90.323758 where: bonds (distance) C4'-P energy: -13.902 bonds (distance) P-C4' energy: -23.815 flat angles C4'-P-C4' energy: -25.652 flat angles P-C4'-P energy: -13.680 tors. eta vs tors. theta energy: -13.275 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 93 Temperature: 0.900000 Total energy: -467.268175 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.268175 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.268175 (E_RNA) where: Base-Base interactions energy: -317.814 where: short stacking energy: -147.106 Base-Backbone interact. energy: -0.610 local terms energy: -148.844295 where: bonds (distance) C4'-P energy: -27.675 bonds (distance) P-C4' energy: -27.421 flat angles C4'-P-C4' energy: -31.037 flat angles P-C4'-P energy: -18.918 tors. eta vs tors. theta energy: -43.793 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 93 Temperature: 0.950000 Total energy: -466.392969 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.392969 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.392969 (E_RNA) where: Base-Base interactions energy: -323.130 where: short stacking energy: -145.336 Base-Backbone interact. energy: -0.890 local terms energy: -142.373497 where: bonds (distance) C4'-P energy: -21.523 bonds (distance) P-C4' energy: -25.940 flat angles C4'-P-C4' energy: -28.498 flat angles P-C4'-P energy: -22.803 tors. eta vs tors. theta energy: -43.610 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 93 Temperature: 1.000000 Total energy: -448.750319 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -448.750319 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -448.750319 (E_RNA) where: Base-Base interactions energy: -316.226 where: short stacking energy: -143.232 Base-Backbone interact. energy: -0.628 local terms energy: -131.896076 where: bonds (distance) C4'-P energy: -21.724 bonds (distance) P-C4' energy: -21.844 flat angles C4'-P-C4' energy: -27.892 flat angles P-C4'-P energy: -23.169 tors. eta vs tors. theta energy: -37.267 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 93 Temperature: 1.050000 Total energy: -430.320263 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.320263 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.320263 (E_RNA) where: Base-Base interactions energy: -298.441 where: short stacking energy: -126.610 Base-Backbone interact. energy: 0.365 local terms energy: -132.244153 where: bonds (distance) C4'-P energy: -31.977 bonds (distance) P-C4' energy: -15.657 flat angles C4'-P-C4' energy: -26.839 flat angles P-C4'-P energy: -20.317 tors. eta vs tors. theta energy: -37.454 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 93 Temperature: 1.100000 Total energy: -408.033942 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -408.033942 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -408.033942 (E_RNA) where: Base-Base interactions energy: -282.037 where: short stacking energy: -123.987 Base-Backbone interact. energy: -0.658 local terms energy: -125.339310 where: bonds (distance) C4'-P energy: -15.624 bonds (distance) P-C4' energy: -28.044 flat angles C4'-P-C4' energy: -29.053 flat angles P-C4'-P energy: -19.922 tors. eta vs tors. theta energy: -32.696 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 93 Temperature: 1.150000 Total energy: -343.774360 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -343.774360 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -343.774360 (E_RNA) where: Base-Base interactions energy: -229.096 where: short stacking energy: -104.283 Base-Backbone interact. energy: -0.648 local terms energy: -114.030972 where: bonds (distance) C4'-P energy: -23.717 bonds (distance) P-C4' energy: -27.104 flat angles C4'-P-C4' energy: -23.880 flat angles P-C4'-P energy: -12.440 tors. eta vs tors. theta energy: -26.890 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 5 ===================================== Write number: 93 Temperature: 1.200000 Total energy: -294.268153 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -294.268153 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -294.268153 (E_RNA) where: Base-Base interactions energy: -188.308 where: short stacking energy: -92.929 Base-Backbone interact. energy: -0.855 local terms energy: -105.105304 where: bonds (distance) C4'-P energy: -25.262 bonds (distance) P-C4' energy: -21.390 flat angles C4'-P-C4' energy: -25.200 flat angles P-C4'-P energy: -12.785 tors. eta vs tors. theta energy: -20.469 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 93 Temperature: 1.250000 Total energy: -258.783255 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -258.783255 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -258.783255 (E_RNA) where: Base-Base interactions energy: -167.614 where: short stacking energy: -80.461 Base-Backbone interact. energy: -0.171 local terms energy: -90.998062 where: bonds (distance) C4'-P energy: -19.572 bonds (distance) P-C4' energy: -22.423 flat angles C4'-P-C4' energy: -21.452 flat angles P-C4'-P energy: -14.473 tors. eta vs tors. theta energy: -13.078 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 93 Temperature: 1.300000 Total energy: -236.023878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -236.023878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -236.023878 (E_RNA) where: Base-Base interactions energy: -156.747 where: short stacking energy: -72.619 Base-Backbone interact. energy: -0.504 local terms energy: -78.772356 where: bonds (distance) C4'-P energy: -19.883 bonds (distance) P-C4' energy: -19.312 flat angles C4'-P-C4' energy: -22.092 flat angles P-C4'-P energy: -11.832 tors. eta vs tors. theta energy: -5.654 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 93 Temperature: 1.350000 Total energy: -230.545207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -230.545207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -230.545207 (E_RNA) where: Base-Base interactions energy: -134.824 where: short stacking energy: -69.198 Base-Backbone interact. energy: -0.528 local terms energy: -95.192524 where: bonds (distance) C4'-P energy: -22.890 bonds (distance) P-C4' energy: -20.534 flat angles C4'-P-C4' energy: -19.713 flat angles P-C4'-P energy: -14.269 tors. eta vs tors. theta energy: -17.786 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 94 Temperature: 0.900000 Total energy: -463.838733 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -463.838733 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -463.838733 (E_RNA) where: Base-Base interactions energy: -317.857 where: short stacking energy: -149.857 Base-Backbone interact. energy: -0.037 local terms energy: -145.944837 where: bonds (distance) C4'-P energy: -24.795 bonds (distance) P-C4' energy: -27.524 flat angles C4'-P-C4' energy: -31.017 flat angles P-C4'-P energy: -20.060 tors. eta vs tors. theta energy: -42.549 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 94 Temperature: 0.950000 Total energy: -456.398730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -456.398730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -456.398730 (E_RNA) where: Base-Base interactions energy: -321.138 where: short stacking energy: -142.028 Base-Backbone interact. energy: -0.050 local terms energy: -135.210517 where: bonds (distance) C4'-P energy: -22.139 bonds (distance) P-C4' energy: -18.387 flat angles C4'-P-C4' energy: -30.357 flat angles P-C4'-P energy: -22.568 tors. eta vs tors. theta energy: -41.759 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 94 Temperature: 1.000000 Total energy: -431.488637 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -431.488637 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -431.488637 (E_RNA) where: Base-Base interactions energy: -304.727 where: short stacking energy: -138.161 Base-Backbone interact. energy: -0.151 local terms energy: -126.610069 where: bonds (distance) C4'-P energy: -22.937 bonds (distance) P-C4' energy: -21.961 flat angles C4'-P-C4' energy: -27.818 flat angles P-C4'-P energy: -16.459 tors. eta vs tors. theta energy: -37.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 94 Temperature: 1.050000 Total energy: -430.866280 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -430.866280 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -430.866280 (E_RNA) where: Base-Base interactions energy: -304.242 where: short stacking energy: -124.818 Base-Backbone interact. energy: -0.931 local terms energy: -125.692662 where: bonds (distance) C4'-P energy: -24.537 bonds (distance) P-C4' energy: -22.299 flat angles C4'-P-C4' energy: -29.828 flat angles P-C4'-P energy: -15.521 tors. eta vs tors. theta energy: -33.509 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 94 Temperature: 1.100000 Total energy: -407.593250 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -407.593250 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -407.593250 (E_RNA) where: Base-Base interactions energy: -278.426 where: short stacking energy: -126.183 Base-Backbone interact. energy: -1.343 local terms energy: -127.823978 where: bonds (distance) C4'-P energy: -25.440 bonds (distance) P-C4' energy: -14.737 flat angles C4'-P-C4' energy: -28.200 flat angles P-C4'-P energy: -20.619 tors. eta vs tors. theta energy: -38.828 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 94 Temperature: 1.150000 Total energy: -356.143501 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -356.143501 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -356.143501 (E_RNA) where: Base-Base interactions energy: -240.610 where: short stacking energy: -114.479 Base-Backbone interact. energy: -0.953 local terms energy: -114.580168 where: bonds (distance) C4'-P energy: -22.108 bonds (distance) P-C4' energy: -20.722 flat angles C4'-P-C4' energy: -25.387 flat angles P-C4'-P energy: -17.131 tors. eta vs tors. theta energy: -29.231 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 94 Temperature: 1.200000 Total energy: -298.277452 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -298.277452 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -298.277452 (E_RNA) where: Base-Base interactions energy: -173.357 where: short stacking energy: -88.162 Base-Backbone interact. energy: -0.215 local terms energy: -124.705348 where: bonds (distance) C4'-P energy: -22.886 bonds (distance) P-C4' energy: -28.762 flat angles C4'-P-C4' energy: -25.908 flat angles P-C4'-P energy: -23.310 tors. eta vs tors. theta energy: -23.840 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 94 Temperature: 1.250000 Total energy: -247.670687 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -247.670687 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -247.670687 (E_RNA) where: Base-Base interactions energy: -159.656 where: short stacking energy: -79.225 Base-Backbone interact. energy: -0.032 local terms energy: -87.982583 where: bonds (distance) C4'-P energy: -20.518 bonds (distance) P-C4' energy: -22.401 flat angles C4'-P-C4' energy: -17.740 flat angles P-C4'-P energy: -8.691 tors. eta vs tors. theta energy: -18.633 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 94 Temperature: 1.300000 Total energy: -232.732559 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -232.732559 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -232.732559 (E_RNA) where: Base-Base interactions energy: -144.740 where: short stacking energy: -70.425 Base-Backbone interact. energy: -1.653 local terms energy: -86.340170 where: bonds (distance) C4'-P energy: -23.199 bonds (distance) P-C4' energy: -27.713 flat angles C4'-P-C4' energy: -21.179 flat angles P-C4'-P energy: -10.440 tors. eta vs tors. theta energy: -3.809 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 94 Temperature: 1.350000 Total energy: -224.127750 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.127750 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.127750 (E_RNA) where: Base-Base interactions energy: -134.311 where: short stacking energy: -69.326 Base-Backbone interact. energy: -0.380 local terms energy: -89.437138 where: bonds (distance) C4'-P energy: -20.099 bonds (distance) P-C4' energy: -28.424 flat angles C4'-P-C4' energy: -17.604 flat angles P-C4'-P energy: -8.990 tors. eta vs tors. theta energy: -14.319 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 95 Temperature: 0.900000 Total energy: -467.153465 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -467.153465 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -467.153465 (E_RNA) where: Base-Base interactions energy: -319.325 where: short stacking energy: -151.611 Base-Backbone interact. energy: -0.351 local terms energy: -147.477940 where: bonds (distance) C4'-P energy: -28.037 bonds (distance) P-C4' energy: -29.792 flat angles C4'-P-C4' energy: -26.707 flat angles P-C4'-P energy: -19.901 tors. eta vs tors. theta energy: -43.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 95 Temperature: 0.950000 Total energy: -462.441906 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -462.441906 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -462.441906 (E_RNA) where: Base-Base interactions energy: -320.953 where: short stacking energy: -153.787 Base-Backbone interact. energy: -0.043 local terms energy: -141.445535 where: bonds (distance) C4'-P energy: -21.956 bonds (distance) P-C4' energy: -29.224 flat angles C4'-P-C4' energy: -31.051 flat angles P-C4'-P energy: -18.357 tors. eta vs tors. theta energy: -40.858 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 95 Temperature: 1.000000 Total energy: -444.464105 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -444.464105 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -444.464105 (E_RNA) where: Base-Base interactions energy: -304.574 where: short stacking energy: -141.127 Base-Backbone interact. energy: -0.175 local terms energy: -139.714965 where: bonds (distance) C4'-P energy: -23.643 bonds (distance) P-C4' energy: -25.465 flat angles C4'-P-C4' energy: -27.833 flat angles P-C4'-P energy: -23.242 tors. eta vs tors. theta energy: -39.531 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 95 Temperature: 1.050000 Total energy: -439.905634 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -439.905634 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -439.905634 (E_RNA) where: Base-Base interactions energy: -309.094 where: short stacking energy: -134.557 Base-Backbone interact. energy: -0.350 local terms energy: -130.462192 where: bonds (distance) C4'-P energy: -23.274 bonds (distance) P-C4' energy: -18.997 flat angles C4'-P-C4' energy: -28.607 flat angles P-C4'-P energy: -17.643 tors. eta vs tors. theta energy: -41.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 95 Temperature: 1.100000 Total energy: -401.448384 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -401.448384 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -401.448384 (E_RNA) where: Base-Base interactions energy: -283.578 where: short stacking energy: -126.374 Base-Backbone interact. energy: -1.866 local terms energy: -116.003879 where: bonds (distance) C4'-P energy: -20.836 bonds (distance) P-C4' energy: -25.907 flat angles C4'-P-C4' energy: -23.461 flat angles P-C4'-P energy: -11.172 tors. eta vs tors. theta energy: -34.628 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 95 Temperature: 1.150000 Total energy: -361.630107 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -361.630107 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -361.630107 (E_RNA) where: Base-Base interactions energy: -247.851 where: short stacking energy: -106.625 Base-Backbone interact. energy: -0.056 local terms energy: -113.722861 where: bonds (distance) C4'-P energy: -21.017 bonds (distance) P-C4' energy: -18.221 flat angles C4'-P-C4' energy: -29.216 flat angles P-C4'-P energy: -17.334 tors. eta vs tors. theta energy: -27.936 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 95 Temperature: 1.200000 Total energy: -332.943833 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -332.943833 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -332.943833 (E_RNA) where: Base-Base interactions energy: -215.381 where: short stacking energy: -111.943 Base-Backbone interact. energy: -1.680 local terms energy: -115.882929 where: bonds (distance) C4'-P energy: -24.194 bonds (distance) P-C4' energy: -21.351 flat angles C4'-P-C4' energy: -21.500 flat angles P-C4'-P energy: -20.804 tors. eta vs tors. theta energy: -28.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 95 Temperature: 1.250000 Total energy: -238.280544 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -238.280544 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -238.280544 (E_RNA) where: Base-Base interactions energy: -143.118 where: short stacking energy: -70.127 Base-Backbone interact. energy: -0.389 local terms energy: -94.773178 where: bonds (distance) C4'-P energy: -17.882 bonds (distance) P-C4' energy: -24.777 flat angles C4'-P-C4' energy: -20.321 flat angles P-C4'-P energy: -13.872 tors. eta vs tors. theta energy: -17.921 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 95 Temperature: 1.300000 Total energy: -233.507141 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -233.507141 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -233.507141 (E_RNA) where: Base-Base interactions energy: -141.451 where: short stacking energy: -77.576 Base-Backbone interact. energy: -0.574 local terms energy: -91.481568 where: bonds (distance) C4'-P energy: -21.121 bonds (distance) P-C4' energy: -25.479 flat angles C4'-P-C4' energy: -18.076 flat angles P-C4'-P energy: -9.586 tors. eta vs tors. theta energy: -17.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 10 ===================================== Write number: 95 Temperature: 1.350000 Total energy: -234.542953 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -234.542953 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -234.542953 (E_RNA) where: Base-Base interactions energy: -156.819 where: short stacking energy: -69.823 Base-Backbone interact. energy: 0.016 local terms energy: -77.739443 where: bonds (distance) C4'-P energy: -6.902 bonds (distance) P-C4' energy: -22.953 flat angles C4'-P-C4' energy: -27.028 flat angles P-C4'-P energy: -10.627 tors. eta vs tors. theta energy: -10.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 96 Temperature: 0.900000 Total energy: -465.821760 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -465.821760 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -465.821760 (E_RNA) where: Base-Base interactions energy: -313.924 where: short stacking energy: -142.598 Base-Backbone interact. energy: -2.129 local terms energy: -149.768524 where: bonds (distance) C4'-P energy: -26.909 bonds (distance) P-C4' energy: -24.618 flat angles C4'-P-C4' energy: -32.636 flat angles P-C4'-P energy: -23.543 tors. eta vs tors. theta energy: -42.061 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 96 Temperature: 0.950000 Total energy: -466.615304 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.615304 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.615304 (E_RNA) where: Base-Base interactions energy: -318.412 where: short stacking energy: -140.730 Base-Backbone interact. energy: -1.170 local terms energy: -147.033730 where: bonds (distance) C4'-P energy: -26.678 bonds (distance) P-C4' energy: -26.348 flat angles C4'-P-C4' energy: -29.073 flat angles P-C4'-P energy: -22.675 tors. eta vs tors. theta energy: -42.259 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 96 Temperature: 1.000000 Total energy: -450.350753 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -450.350753 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -450.350753 (E_RNA) where: Base-Base interactions energy: -319.009 where: short stacking energy: -151.003 Base-Backbone interact. energy: -2.193 local terms energy: -129.149258 where: bonds (distance) C4'-P energy: -19.267 bonds (distance) P-C4' energy: -22.306 flat angles C4'-P-C4' energy: -28.187 flat angles P-C4'-P energy: -21.320 tors. eta vs tors. theta energy: -38.069 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 96 Temperature: 1.050000 Total energy: -423.945353 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -423.945353 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -423.945353 (E_RNA) where: Base-Base interactions energy: -294.621 where: short stacking energy: -131.296 Base-Backbone interact. energy: -0.282 local terms energy: -129.042393 where: bonds (distance) C4'-P energy: -26.537 bonds (distance) P-C4' energy: -20.944 flat angles C4'-P-C4' energy: -27.958 flat angles P-C4'-P energy: -18.837 tors. eta vs tors. theta energy: -34.766 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 96 Temperature: 1.100000 Total energy: -371.300330 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -371.300330 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -371.300330 (E_RNA) where: Base-Base interactions energy: -253.714 where: short stacking energy: -116.704 Base-Backbone interact. energy: -0.175 local terms energy: -117.411132 where: bonds (distance) C4'-P energy: -19.261 bonds (distance) P-C4' energy: -22.284 flat angles C4'-P-C4' energy: -29.185 flat angles P-C4'-P energy: -15.779 tors. eta vs tors. theta energy: -30.902 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 96 Temperature: 1.150000 Total energy: -402.121000 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -402.121000 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -402.121000 (E_RNA) where: Base-Base interactions energy: -277.320 where: short stacking energy: -118.940 Base-Backbone interact. energy: -1.401 local terms energy: -123.399442 where: bonds (distance) C4'-P energy: -22.878 bonds (distance) P-C4' energy: -18.491 flat angles C4'-P-C4' energy: -25.824 flat angles P-C4'-P energy: -23.029 tors. eta vs tors. theta energy: -33.178 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 96 Temperature: 1.200000 Total energy: -329.239808 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -329.239808 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -329.239808 (E_RNA) where: Base-Base interactions energy: -221.424 where: short stacking energy: -110.293 Base-Backbone interact. energy: 0.661 local terms energy: -108.477075 where: bonds (distance) C4'-P energy: -22.503 bonds (distance) P-C4' energy: -21.175 flat angles C4'-P-C4' energy: -27.999 flat angles P-C4'-P energy: -14.185 tors. eta vs tors. theta energy: -22.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 6 ===================================== Write number: 96 Temperature: 1.250000 Total energy: -248.957640 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -248.957640 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -248.957640 (E_RNA) where: Base-Base interactions energy: -145.268 where: short stacking energy: -74.965 Base-Backbone interact. energy: -0.961 local terms energy: -102.728700 where: bonds (distance) C4'-P energy: -21.224 bonds (distance) P-C4' energy: -28.350 flat angles C4'-P-C4' energy: -19.781 flat angles P-C4'-P energy: -17.623 tors. eta vs tors. theta energy: -15.751 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 10 ===================================== Write number: 96 Temperature: 1.300000 Total energy: -219.366444 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -219.366444 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -219.366444 (E_RNA) where: Base-Base interactions energy: -137.557 where: short stacking energy: -65.097 Base-Backbone interact. energy: -0.270 local terms energy: -81.539795 where: bonds (distance) C4'-P energy: -22.259 bonds (distance) P-C4' energy: -24.346 flat angles C4'-P-C4' energy: -14.492 flat angles P-C4'-P energy: -7.009 tors. eta vs tors. theta energy: -13.435 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 96 Temperature: 1.350000 Total energy: -229.346168 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -229.346168 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -229.346168 (E_RNA) where: Base-Base interactions energy: -133.358 where: short stacking energy: -79.702 Base-Backbone interact. energy: -1.427 local terms energy: -94.560746 where: bonds (distance) C4'-P energy: -24.464 bonds (distance) P-C4' energy: -20.895 flat angles C4'-P-C4' energy: -16.878 flat angles P-C4'-P energy: -16.863 tors. eta vs tors. theta energy: -15.461 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 97 Temperature: 0.900000 Total energy: -469.186491 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.186491 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.186491 (E_RNA) where: Base-Base interactions energy: -324.490 where: short stacking energy: -137.863 Base-Backbone interact. energy: -0.966 local terms energy: -143.731062 where: bonds (distance) C4'-P energy: -27.958 bonds (distance) P-C4' energy: -24.290 flat angles C4'-P-C4' energy: -29.725 flat angles P-C4'-P energy: -19.455 tors. eta vs tors. theta energy: -42.303 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 97 Temperature: 0.950000 Total energy: -454.370569 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -454.370569 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -454.370569 (E_RNA) where: Base-Base interactions energy: -318.204 where: short stacking energy: -142.670 Base-Backbone interact. energy: -0.500 local terms energy: -135.666815 where: bonds (distance) C4'-P energy: -23.928 bonds (distance) P-C4' energy: -21.633 flat angles C4'-P-C4' energy: -26.780 flat angles P-C4'-P energy: -21.312 tors. eta vs tors. theta energy: -42.013 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 97 Temperature: 1.000000 Total energy: -455.407391 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -455.407391 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -455.407391 (E_RNA) where: Base-Base interactions energy: -315.807 where: short stacking energy: -134.535 Base-Backbone interact. energy: 1.963 local terms energy: -141.562818 where: bonds (distance) C4'-P energy: -23.775 bonds (distance) P-C4' energy: -27.240 flat angles C4'-P-C4' energy: -30.479 flat angles P-C4'-P energy: -21.636 tors. eta vs tors. theta energy: -38.433 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 97 Temperature: 1.050000 Total energy: -373.559398 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -373.559398 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -373.559398 (E_RNA) where: Base-Base interactions energy: -239.100 where: short stacking energy: -107.566 Base-Backbone interact. energy: -0.409 local terms energy: -134.050074 where: bonds (distance) C4'-P energy: -27.934 bonds (distance) P-C4' energy: -31.617 flat angles C4'-P-C4' energy: -25.610 flat angles P-C4'-P energy: -18.273 tors. eta vs tors. theta energy: -30.616 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 97 Temperature: 1.100000 Total energy: -413.868695 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -413.868695 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -413.868695 (E_RNA) where: Base-Base interactions energy: -289.325 where: short stacking energy: -127.136 Base-Backbone interact. energy: -0.286 local terms energy: -124.258576 where: bonds (distance) C4'-P energy: -24.124 bonds (distance) P-C4' energy: -24.216 flat angles C4'-P-C4' energy: -23.922 flat angles P-C4'-P energy: -13.785 tors. eta vs tors. theta energy: -38.211 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 97 Temperature: 1.150000 Total energy: -390.558794 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -390.558794 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -390.558794 (E_RNA) where: Base-Base interactions energy: -264.329 where: short stacking energy: -107.521 Base-Backbone interact. energy: -0.238 local terms energy: -125.991755 where: bonds (distance) C4'-P energy: -21.305 bonds (distance) P-C4' energy: -30.367 flat angles C4'-P-C4' energy: -25.806 flat angles P-C4'-P energy: -14.375 tors. eta vs tors. theta energy: -34.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 97 Temperature: 1.200000 Total energy: -345.055149 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -345.055149 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -345.055149 (E_RNA) where: Base-Base interactions energy: -232.605 where: short stacking energy: -119.389 Base-Backbone interact. energy: -0.525 local terms energy: -111.925431 where: bonds (distance) C4'-P energy: -17.208 bonds (distance) P-C4' energy: -20.663 flat angles C4'-P-C4' energy: -26.352 flat angles P-C4'-P energy: -15.674 tors. eta vs tors. theta energy: -32.029 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 97 Temperature: 1.250000 Total energy: -228.825623 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.825623 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.825623 (E_RNA) where: Base-Base interactions energy: -125.507 where: short stacking energy: -66.832 Base-Backbone interact. energy: 1.017 local terms energy: -104.335685 where: bonds (distance) C4'-P energy: -24.942 bonds (distance) P-C4' energy: -25.402 flat angles C4'-P-C4' energy: -29.759 flat angles P-C4'-P energy: -18.910 tors. eta vs tors. theta energy: -5.323 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 6 ===================================== Write number: 97 Temperature: 1.300000 Total energy: -213.247638 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.247638 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.247638 (E_RNA) where: Base-Base interactions energy: -126.432 where: short stacking energy: -68.700 Base-Backbone interact. energy: 0.950 local terms energy: -87.765436 where: bonds (distance) C4'-P energy: -21.729 bonds (distance) P-C4' energy: -24.902 flat angles C4'-P-C4' energy: -25.398 flat angles P-C4'-P energy: -6.351 tors. eta vs tors. theta energy: -9.385 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 5 ===================================== Write number: 97 Temperature: 1.350000 Total energy: -224.422011 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -224.422011 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -224.422011 (E_RNA) where: Base-Base interactions energy: -133.717 where: short stacking energy: -73.771 Base-Backbone interact. energy: -0.216 local terms energy: -90.489183 where: bonds (distance) C4'-P energy: -27.181 bonds (distance) P-C4' energy: -12.501 flat angles C4'-P-C4' energy: -22.901 flat angles P-C4'-P energy: -11.983 tors. eta vs tors. theta energy: -15.923 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 98 Temperature: 0.900000 Total energy: -469.773739 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -469.773739 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -469.773739 (E_RNA) where: Base-Base interactions energy: -322.852 where: short stacking energy: -149.033 Base-Backbone interact. energy: 0.392 local terms energy: -147.314097 where: bonds (distance) C4'-P energy: -26.831 bonds (distance) P-C4' energy: -31.704 flat angles C4'-P-C4' energy: -28.617 flat angles P-C4'-P energy: -18.872 tors. eta vs tors. theta energy: -41.290 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 98 Temperature: 0.950000 Total energy: -457.506163 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -457.506163 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -457.506163 (E_RNA) where: Base-Base interactions energy: -308.608 where: short stacking energy: -140.545 Base-Backbone interact. energy: -2.246 local terms energy: -146.652065 where: bonds (distance) C4'-P energy: -23.598 bonds (distance) P-C4' energy: -28.499 flat angles C4'-P-C4' energy: -31.713 flat angles P-C4'-P energy: -22.280 tors. eta vs tors. theta energy: -40.561 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 98 Temperature: 1.000000 Total energy: -433.811878 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.811878 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.811878 (E_RNA) where: Base-Base interactions energy: -301.641 where: short stacking energy: -126.158 Base-Backbone interact. energy: 0.971 local terms energy: -133.141699 where: bonds (distance) C4'-P energy: -26.259 bonds (distance) P-C4' energy: -28.876 flat angles C4'-P-C4' energy: -23.619 flat angles P-C4'-P energy: -20.030 tors. eta vs tors. theta energy: -34.359 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 9 ===================================== Write number: 98 Temperature: 1.050000 Total energy: -378.171730 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -378.171730 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -378.171730 (E_RNA) where: Base-Base interactions energy: -248.312 where: short stacking energy: -106.762 Base-Backbone interact. energy: -0.596 local terms energy: -129.263458 where: bonds (distance) C4'-P energy: -24.471 bonds (distance) P-C4' energy: -26.879 flat angles C4'-P-C4' energy: -29.497 flat angles P-C4'-P energy: -20.369 tors. eta vs tors. theta energy: -28.049 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 1 ===================================== Write number: 98 Temperature: 1.100000 Total energy: -403.273800 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -403.273800 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -403.273800 (E_RNA) where: Base-Base interactions energy: -273.133 where: short stacking energy: -121.119 Base-Backbone interact. energy: -1.014 local terms energy: -129.127040 where: bonds (distance) C4'-P energy: -24.779 bonds (distance) P-C4' energy: -24.549 flat angles C4'-P-C4' energy: -27.426 flat angles P-C4'-P energy: -16.075 tors. eta vs tors. theta energy: -36.298 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 98 Temperature: 1.150000 Total energy: -394.823207 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -394.823207 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -394.823207 (E_RNA) where: Base-Base interactions energy: -270.494 where: short stacking energy: -129.673 Base-Backbone interact. energy: -0.047 local terms energy: -124.282041 where: bonds (distance) C4'-P energy: -24.004 bonds (distance) P-C4' energy: -21.414 flat angles C4'-P-C4' energy: -26.438 flat angles P-C4'-P energy: -15.811 tors. eta vs tors. theta energy: -36.615 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 98 Temperature: 1.200000 Total energy: -334.668293 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -334.668293 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -334.668293 (E_RNA) where: Base-Base interactions energy: -222.633 where: short stacking energy: -99.444 Base-Backbone interact. energy: -0.820 local terms energy: -111.216063 where: bonds (distance) C4'-P energy: -21.307 bonds (distance) P-C4' energy: -27.601 flat angles C4'-P-C4' energy: -25.707 flat angles P-C4'-P energy: -12.476 tors. eta vs tors. theta energy: -24.125 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 98 Temperature: 1.250000 Total energy: -245.960759 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -245.960759 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -245.960759 (E_RNA) where: Base-Base interactions energy: -149.660 where: short stacking energy: -82.443 Base-Backbone interact. energy: -0.019 local terms energy: -96.282181 where: bonds (distance) C4'-P energy: -24.094 bonds (distance) P-C4' energy: -23.272 flat angles C4'-P-C4' energy: -18.021 flat angles P-C4'-P energy: -15.645 tors. eta vs tors. theta energy: -15.250 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 98 Temperature: 1.300000 Total energy: -228.398474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -228.398474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -228.398474 (E_RNA) where: Base-Base interactions energy: -143.175 where: short stacking energy: -67.239 Base-Backbone interact. energy: -1.684 local terms energy: -83.539331 where: bonds (distance) C4'-P energy: -15.886 bonds (distance) P-C4' energy: -26.313 flat angles C4'-P-C4' energy: -21.455 flat angles P-C4'-P energy: -10.703 tors. eta vs tors. theta energy: -9.183 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 98 Temperature: 1.350000 Total energy: -213.167891 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -213.167891 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -213.167891 (E_RNA) where: Base-Base interactions energy: -134.771 where: short stacking energy: -69.423 Base-Backbone interact. energy: -0.197 local terms energy: -78.199599 where: bonds (distance) C4'-P energy: -14.364 bonds (distance) P-C4' energy: -20.448 flat angles C4'-P-C4' energy: -22.148 flat angles P-C4'-P energy: -14.099 tors. eta vs tors. theta energy: -7.140 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 7 ===================================== Write number: 99 Temperature: 0.900000 Total energy: -464.170458 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -464.170458 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -464.170458 (E_RNA) where: Base-Base interactions energy: -314.811 where: short stacking energy: -144.514 Base-Backbone interact. energy: -0.181 local terms energy: -149.178771 where: bonds (distance) C4'-P energy: -29.093 bonds (distance) P-C4' energy: -30.472 flat angles C4'-P-C4' energy: -29.644 flat angles P-C4'-P energy: -17.676 tors. eta vs tors. theta energy: -42.293 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 4 ===================================== Write number: 99 Temperature: 0.950000 Total energy: -458.125646 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.125646 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.125646 (E_RNA) where: Base-Base interactions energy: -309.311 where: short stacking energy: -147.303 Base-Backbone interact. energy: -0.172 local terms energy: -148.642845 where: bonds (distance) C4'-P energy: -27.545 bonds (distance) P-C4' energy: -24.627 flat angles C4'-P-C4' energy: -31.625 flat angles P-C4'-P energy: -22.819 tors. eta vs tors. theta energy: -42.027 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 2 ===================================== Write number: 99 Temperature: 1.000000 Total energy: -447.114957 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.114957 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.114957 (E_RNA) where: Base-Base interactions energy: -313.314 where: short stacking energy: -137.365 Base-Backbone interact. energy: -0.022 local terms energy: -133.778916 where: bonds (distance) C4'-P energy: -24.508 bonds (distance) P-C4' energy: -26.488 flat angles C4'-P-C4' energy: -24.377 flat angles P-C4'-P energy: -21.365 tors. eta vs tors. theta energy: -37.041 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 1 ===================================== Write number: 99 Temperature: 1.050000 Total energy: -416.397198 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -416.397198 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -416.397198 (E_RNA) where: Base-Base interactions energy: -282.600 where: short stacking energy: -123.602 Base-Backbone interact. energy: -1.866 local terms energy: -131.930813 where: bonds (distance) C4'-P energy: -28.077 bonds (distance) P-C4' energy: -27.006 flat angles C4'-P-C4' energy: -28.142 flat angles P-C4'-P energy: -17.999 tors. eta vs tors. theta energy: -30.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 9 ===================================== Write number: 99 Temperature: 1.100000 Total energy: -370.036731 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -370.036731 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -370.036731 (E_RNA) where: Base-Base interactions energy: -242.095 where: short stacking energy: -113.949 Base-Backbone interact. energy: -1.440 local terms energy: -126.501997 where: bonds (distance) C4'-P energy: -23.891 bonds (distance) P-C4' energy: -19.467 flat angles C4'-P-C4' energy: -28.850 flat angles P-C4'-P energy: -23.550 tors. eta vs tors. theta energy: -30.743 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 3 ===================================== Write number: 99 Temperature: 1.150000 Total energy: -381.066409 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -381.066409 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -381.066409 (E_RNA) where: Base-Base interactions energy: -252.712 where: short stacking energy: -123.101 Base-Backbone interact. energy: -1.357 local terms energy: -126.997256 where: bonds (distance) C4'-P energy: -20.367 bonds (distance) P-C4' energy: -25.772 flat angles C4'-P-C4' energy: -25.185 flat angles P-C4'-P energy: -20.754 tors. eta vs tors. theta energy: -34.919 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 8 ===================================== Write number: 99 Temperature: 1.200000 Total energy: -315.503030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -315.503030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -315.503030 (E_RNA) where: Base-Base interactions energy: -202.205 where: short stacking energy: -91.426 Base-Backbone interact. energy: -0.089 local terms energy: -113.209702 where: bonds (distance) C4'-P energy: -21.580 bonds (distance) P-C4' energy: -26.009 flat angles C4'-P-C4' energy: -23.251 flat angles P-C4'-P energy: -18.021 tors. eta vs tors. theta energy: -24.348 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 10 ===================================== Write number: 99 Temperature: 1.250000 Total energy: -235.527126 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -235.527126 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -235.527126 (E_RNA) where: Base-Base interactions energy: -145.595 where: short stacking energy: -75.051 Base-Backbone interact. energy: -0.339 local terms energy: -89.593708 where: bonds (distance) C4'-P energy: -17.395 bonds (distance) P-C4' energy: -24.472 flat angles C4'-P-C4' energy: -22.958 flat angles P-C4'-P energy: -15.482 tors. eta vs tors. theta energy: -9.287 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 99 Temperature: 1.300000 Total energy: -246.988992 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -246.988992 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -246.988992 (E_RNA) where: Base-Base interactions energy: -141.195 where: short stacking energy: -69.300 Base-Backbone interact. energy: -0.674 local terms energy: -105.119600 where: bonds (distance) C4'-P energy: -19.222 bonds (distance) P-C4' energy: -27.219 flat angles C4'-P-C4' energy: -26.306 flat angles P-C4'-P energy: -17.798 tors. eta vs tors. theta energy: -14.575 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 99 Temperature: 1.350000 Total energy: -214.036751 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -214.036751 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -214.036751 (E_RNA) where: Base-Base interactions energy: -138.039 where: short stacking energy: -65.923 Base-Backbone interact. energy: 1.539 local terms energy: -77.536778 where: bonds (distance) C4'-P energy: -20.369 bonds (distance) P-C4' energy: -13.733 flat angles C4'-P-C4' energy: -21.576 flat angles P-C4'-P energy: -14.246 tors. eta vs tors. theta energy: -7.613 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 100 Temperature: 0.900000 Total energy: -466.384747 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -466.384747 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -466.384747 (E_RNA) where: Base-Base interactions energy: -316.512 where: short stacking energy: -142.101 Base-Backbone interact. energy: -0.031 local terms energy: -149.841360 where: bonds (distance) C4'-P energy: -24.832 bonds (distance) P-C4' energy: -31.306 flat angles C4'-P-C4' energy: -30.515 flat angles P-C4'-P energy: -22.999 tors. eta vs tors. theta energy: -40.189 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 100 Temperature: 0.950000 Total energy: -446.261740 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -446.261740 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -446.261740 (E_RNA) where: Base-Base interactions energy: -301.322 where: short stacking energy: -137.809 Base-Backbone interact. energy: -0.053 local terms energy: -144.887134 where: bonds (distance) C4'-P energy: -29.407 bonds (distance) P-C4' energy: -30.010 flat angles C4'-P-C4' energy: -31.528 flat angles P-C4'-P energy: -13.301 tors. eta vs tors. theta energy: -40.641 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 100 Temperature: 1.000000 Total energy: -433.436256 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.436256 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.436256 (E_RNA) where: Base-Base interactions energy: -298.273 where: short stacking energy: -135.022 Base-Backbone interact. energy: -1.262 local terms energy: -133.901841 where: bonds (distance) C4'-P energy: -23.970 bonds (distance) P-C4' energy: -26.490 flat angles C4'-P-C4' energy: -28.159 flat angles P-C4'-P energy: -18.641 tors. eta vs tors. theta energy: -36.642 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 100 Temperature: 1.050000 Total energy: -447.326620 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -447.326620 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -447.326620 (E_RNA) where: Base-Base interactions energy: -310.407 where: short stacking energy: -127.156 Base-Backbone interact. energy: -1.152 local terms energy: -135.767773 where: bonds (distance) C4'-P energy: -27.594 bonds (distance) P-C4' energy: -29.363 flat angles C4'-P-C4' energy: -26.156 flat angles P-C4'-P energy: -18.277 tors. eta vs tors. theta energy: -34.379 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 100 Temperature: 1.100000 Total energy: -396.747159 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -396.747159 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -396.747159 (E_RNA) where: Base-Base interactions energy: -273.713 where: short stacking energy: -121.681 Base-Backbone interact. energy: -0.365 local terms energy: -122.669137 where: bonds (distance) C4'-P energy: -24.471 bonds (distance) P-C4' energy: -27.761 flat angles C4'-P-C4' energy: -28.612 flat angles P-C4'-P energy: -10.130 tors. eta vs tors. theta energy: -31.695 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 100 Temperature: 1.150000 Total energy: -359.743030 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -359.743030 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -359.743030 (E_RNA) where: Base-Base interactions energy: -246.737 where: short stacking energy: -110.073 Base-Backbone interact. energy: -0.287 local terms energy: -112.718540 where: bonds (distance) C4'-P energy: -19.217 bonds (distance) P-C4' energy: -24.508 flat angles C4'-P-C4' energy: -25.838 flat angles P-C4'-P energy: -13.134 tors. eta vs tors. theta energy: -30.021 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 100 Temperature: 1.200000 Total energy: -268.858051 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -268.858051 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -268.858051 (E_RNA) where: Base-Base interactions energy: -160.049 where: short stacking energy: -71.899 Base-Backbone interact. energy: -0.485 local terms energy: -108.324553 where: bonds (distance) C4'-P energy: -23.242 bonds (distance) P-C4' energy: -29.253 flat angles C4'-P-C4' energy: -27.714 flat angles P-C4'-P energy: -12.727 tors. eta vs tors. theta energy: -15.389 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 8 ===================================== Write number: 100 Temperature: 1.250000 Total energy: -292.948853 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -292.948853 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -292.948853 (E_RNA) where: Base-Base interactions energy: -196.766 where: short stacking energy: -79.732 Base-Backbone interact. energy: -0.784 local terms energy: -95.398833 where: bonds (distance) C4'-P energy: -10.962 bonds (distance) P-C4' energy: -23.937 flat angles C4'-P-C4' energy: -22.748 flat angles P-C4'-P energy: -21.534 tors. eta vs tors. theta energy: -16.219 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 5 ===================================== Write number: 100 Temperature: 1.300000 Total energy: -264.457147 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -264.457147 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -264.457147 (E_RNA) where: Base-Base interactions energy: -151.840 where: short stacking energy: -82.866 Base-Backbone interact. energy: -0.380 local terms energy: -112.237670 where: bonds (distance) C4'-P energy: -29.778 bonds (distance) P-C4' energy: -20.053 flat angles C4'-P-C4' energy: -23.140 flat angles P-C4'-P energy: -20.126 tors. eta vs tors. theta energy: -19.141 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 100 Temperature: 1.350000 Total energy: -222.261724 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -222.261724 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -222.261724 (E_RNA) where: Base-Base interactions energy: -134.822 where: short stacking energy: -66.440 Base-Backbone interact. energy: -0.576 local terms energy: -86.863424 where: bonds (distance) C4'-P energy: -23.274 bonds (distance) P-C4' energy: -12.690 flat angles C4'-P-C4' energy: -20.598 flat angles P-C4'-P energy: -17.267 tors. eta vs tors. theta energy: -13.035 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 1, replica: 4 ===================================== Write number: 101 Temperature: 0.900000 Total energy: -458.917490 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.917490 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.917490 (E_RNA) where: Base-Base interactions energy: -319.692 where: short stacking energy: -144.271 Base-Backbone interact. energy: -0.730 local terms energy: -138.494965 where: bonds (distance) C4'-P energy: -18.818 bonds (distance) P-C4' energy: -25.788 flat angles C4'-P-C4' energy: -28.757 flat angles P-C4'-P energy: -25.425 tors. eta vs tors. theta energy: -39.707 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 2, replica: 7 ===================================== Write number: 101 Temperature: 0.950000 Total energy: -458.886356 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -458.886356 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -458.886356 (E_RNA) where: Base-Base interactions energy: -317.937 where: short stacking energy: -150.998 Base-Backbone interact. energy: -0.606 local terms energy: -140.343304 where: bonds (distance) C4'-P energy: -28.130 bonds (distance) P-C4' energy: -17.317 flat angles C4'-P-C4' energy: -29.448 flat angles P-C4'-P energy: -21.263 tors. eta vs tors. theta energy: -44.185 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 3, replica: 1 ===================================== Write number: 101 Temperature: 1.000000 Total energy: -433.165557 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -433.165557 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -433.165557 (E_RNA) where: Base-Base interactions energy: -294.502 where: short stacking energy: -137.783 Base-Backbone interact. energy: 0.488 local terms energy: -139.152148 where: bonds (distance) C4'-P energy: -23.954 bonds (distance) P-C4' energy: -26.454 flat angles C4'-P-C4' energy: -30.383 flat angles P-C4'-P energy: -22.131 tors. eta vs tors. theta energy: -36.230 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 4, replica: 2 ===================================== Write number: 101 Temperature: 1.050000 Total energy: -432.546243 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -432.546243 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -432.546243 (E_RNA) where: Base-Base interactions energy: -290.882 where: short stacking energy: -130.568 Base-Backbone interact. energy: -0.701 local terms energy: -140.963634 where: bonds (distance) C4'-P energy: -25.112 bonds (distance) P-C4' energy: -30.338 flat angles C4'-P-C4' energy: -31.111 flat angles P-C4'-P energy: -19.462 tors. eta vs tors. theta energy: -34.940 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 5, replica: 3 ===================================== Write number: 101 Temperature: 1.100000 Total energy: -404.432021 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -404.432021 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -404.432021 (E_RNA) where: Base-Base interactions energy: -276.204 where: short stacking energy: -126.327 Base-Backbone interact. energy: -1.402 local terms energy: -126.825553 where: bonds (distance) C4'-P energy: -21.954 bonds (distance) P-C4' energy: -26.242 flat angles C4'-P-C4' energy: -25.942 flat angles P-C4'-P energy: -19.006 tors. eta vs tors. theta energy: -33.682 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 6, replica: 9 ===================================== Write number: 101 Temperature: 1.150000 Total energy: -344.277576 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -344.277576 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -344.277576 (E_RNA) where: Base-Base interactions energy: -230.670 where: short stacking energy: -93.730 Base-Backbone interact. energy: -1.895 local terms energy: -111.713081 where: bonds (distance) C4'-P energy: -26.607 bonds (distance) P-C4' energy: -24.213 flat angles C4'-P-C4' energy: -25.486 flat angles P-C4'-P energy: -13.860 tors. eta vs tors. theta energy: -21.546 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 7, replica: 10 ===================================== Write number: 101 Temperature: 1.200000 Total energy: -269.339459 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -269.339459 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -269.339459 (E_RNA) where: Base-Base interactions energy: -175.447 where: short stacking energy: -86.692 Base-Backbone interact. energy: -1.127 local terms energy: -92.765295 where: bonds (distance) C4'-P energy: -17.217 bonds (distance) P-C4' energy: -27.902 flat angles C4'-P-C4' energy: -17.676 flat angles P-C4'-P energy: -10.277 tors. eta vs tors. theta energy: -19.694 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 8, replica: 5 ===================================== Write number: 101 Temperature: 1.250000 Total energy: -252.150822 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -252.150822 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -252.150822 (E_RNA) where: Base-Base interactions energy: -146.052 where: short stacking energy: -75.542 Base-Backbone interact. energy: -1.344 local terms energy: -104.755284 where: bonds (distance) C4'-P energy: -24.513 bonds (distance) P-C4' energy: -27.410 flat angles C4'-P-C4' energy: -18.841 flat angles P-C4'-P energy: -17.620 tors. eta vs tors. theta energy: -16.372 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 9, replica: 8 ===================================== Write number: 101 Temperature: 1.300000 Total energy: -305.284474 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -305.284474 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -305.284474 (E_RNA) where: Base-Base interactions energy: -206.590 where: short stacking energy: -88.738 Base-Backbone interact. energy: -1.309 local terms energy: -97.385684 where: bonds (distance) C4'-P energy: -12.638 bonds (distance) P-C4' energy: -25.717 flat angles C4'-P-C4' energy: -26.031 flat angles P-C4'-P energy: -15.049 tors. eta vs tors. theta energy: -17.951 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) ================================== temp. level: 10, replica: 6 ===================================== Write number: 101 Temperature: 1.350000 Total energy: -223.328216 (ES_TOTAL = E_TOTAL + S_TOTAL) where: RNA energy: -223.328216 (E_RNA + S_DIST_RNA + S_LIMSPR_RNA) where: Molecular energy: -223.328216 (E_RNA) where: Base-Base interactions energy: -129.316 where: short stacking energy: -60.945 Base-Backbone interact. energy: -0.080 local terms energy: -93.932913 where: bonds (distance) C4'-P energy: -23.336 bonds (distance) P-C4' energy: -23.375 flat angles C4'-P-C4' energy: -25.025 flat angles P-C4'-P energy: -10.604 tors. eta vs tors. theta energy: -11.593 Dist. restrs. and SS energy: 0.000 (S_DIST_RNA) chem. prob. restrs. energy: 0.000 (S_CHEM_RNA) Limit. sphere exceed penalty: 0.000 (S_LIMSPR_RNA) replica 7 ended at temp. level: 1, temp: 0.900000 for this replica: moves confirmed at first: 3934501 moves confirmed later: 4344674 all moves confirmed: 8279175 percent of confirmed moves: 5.174484 current total energy: -419.391144 recalc. total energy: -419.391144 replica 4 ended at temp. level: 2, temp: 0.950000 for this replica: moves confirmed at first: 5557212 moves confirmed later: 6460077 all moves confirmed: 12017289 percent of confirmed moves: 7.510806 current total energy: -418.127795 recalc. total energy: -418.127795 replica 1 ended at temp. level: 3, temp: 1.000000 for this replica: moves confirmed at first: 4219636 moves confirmed later: 4688535 all moves confirmed: 8908171 percent of confirmed moves: 5.567607 current total energy: -387.108462 recalc. total energy: -387.108462 replica 2 ended at temp. level: 4, temp: 1.050000 for this replica: moves confirmed at first: 3898638 moves confirmed later: 4256225 all moves confirmed: 8154863 percent of confirmed moves: 5.096789 current total energy: -374.379930 recalc. total energy: -374.379930 replica 3 ended at temp. level: 5, temp: 1.100000 for this replica: moves confirmed at first: 4161922 moves confirmed later: 4678279 all moves confirmed: 8840201 percent of confirmed moves: 5.525126 current total energy: -366.184413 recalc. total energy: -366.184413 replica 9 ended at temp. level: 6, temp: 1.150000 for this replica: moves confirmed at first: 5535869 moves confirmed later: 6446040 all moves confirmed: 11981909 percent of confirmed moves: 7.488693 current total energy: -287.508386 recalc. total energy: -287.508386 replica 5 ended at temp. level: 7, temp: 1.200000 for this replica: moves confirmed at first: 7320440 moves confirmed later: 8819108 all moves confirmed: 16139548 percent of confirmed moves: 10.087217 current total energy: -225.627129 recalc. total energy: -225.627129 replica 10 ended at temp. level: 8, temp: 1.250000 for this replica: moves confirmed at first: 7967115 moves confirmed later: 9608140 all moves confirmed: 17575255 percent of confirmed moves: 10.984534 current total energy: -192.290708 recalc. total energy: -192.290708 replica 8 ended at temp. level: 9, temp: 1.300000 for this replica: moves confirmed at first: 6799669 moves confirmed later: 8099629 all moves confirmed: 14899298 percent of confirmed moves: 9.312061 current total energy: -218.038717 recalc. total energy: -218.038717 replica 6 ended at temp. level: 10, temp: 1.350000 for this replica: moves confirmed at first: 5961321 moves confirmed later: 7003556 all moves confirmed: 12964877 percent of confirmed moves: 8.103048 current total energy: -154.483581 recalc. total energy: -154.483581 out arg RESULTS//1/1-0237fbe0_01 Time of doing 1600000 iterations: 762.176 seconds