PubMed ID: 26957420
Abstract:
RNA can form two types of linkage. In addition to the predominant 3′–5′ linkage, 2′–5′‐linked RNA is also important in biology, medicine, and prebiotic studies. Here, in vitro selection was used to isolate a DNAzyme that specifically cleaves 2′–5′ RNA by using Ce3+ as the metal cofactor, but leaves the 3′–5′ counterpart intact. This Ce5 DNAzyme requires trivalent light lanthanide ions and shows a rate of 0.16 min−1 in the presence of 10 μm Ce3+; the activity decreases with heavier lanthanide ions. This is the fastest DNAzyme reported for this reaction, and it might enable applications in chemical biology. As a proof‐of‐concept, using this DNAzyme, the reactions between phosphorothioate‐modified RNA and strongly thiophilic metals (Hg2+ and Tl3+) were studied as a function of pH.
DNAzymes linked to this article:
Name | Isolated sequence | Length | Reaction |
---|---|---|---|
Ce5 | TTTCGCCATCTTTAGGAATATCTATTCCACGGCTCACGAAATAGTGACTCGTGAC | 55 | RNA cleavage |