DNAmoreDB - A Database of Deoxyribozymes

Published on 2016 in Angew. Chem. Int. Ed. Engl. volume 55 issue 7.

PubMed ID: 26676768

DOI:10.1002/anie.201510125

Abstract:

Pathogenic strains of bacteria are known to cause various infectious diseases and there is a growing demand for molecular probes that can selectively recognize them. Here we report a special DNAzyme (catalytic DNA), RFD‐CD1, that shows exquisite specificity for a pathogenic strain of Clostridium difficile (C. difficile). RFD‐CD1 was derived by an in vitro selection approach where a random‐sequence DNA library was allowed to react with an unpurified molecular mixture derived from this strain of C. difficle, coupled with a subtractive selection strategy to eliminate cross‐reactivities to unintended C. difficile strains and other bacteria species. RFD‐CD1 is activated by a truncated version of TcdC, a transcription factor, that is unique to the targeted strain of C. difficle. Our study demonstrates for the first time that in vitro selection offers an effective approach for deriving functional nucleic acid probes that are capable of achieving strain‐specific recognition of bacterial pathogens.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
RFD‐CD1 GATCTGAGTGGATTGGGGCCTGCGCGGAGTCGGGACTATT      40 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra