DNAmoreDB - A Database of Deoxyribozymes

Published on 2019 in ACS Comb Sci volume 21 issue 2.

PubMed ID: 30602113

DOI:10.1021/acscombsci.8b00129

Abstract:

To develop a novel light-up probe and DNAzyme, we selected aptamers for N-methyl mesoporphyrin IX (NMM), a common fluorogenic analogue of coenzyme hemin, by a modified affinity chromatography-based systematic evolution of ligands by exponential enrichment (SELEX). Two truncated aptamers Nm1 and Nm2 with low micromolar dissociation constants (0.75 and 13.27 μM) were obtained after 11 rounds of selection and the final minimized 39-mer aptamer Nm2.1 showed 24-fold fluorescence enhancement for NMM at saturated concentration. Study of the interactions between aptamers and other porphyrin compounds by circular dichroism (CD) and absorption spectroscopy showed that Nm1 mainly assembled as a stem-loop structure, which exhibited a catalytic activity for the metal insertion reaction of mesoporphyrin IX with 3.3-fold rate enhancement. In contrast, the G-rich Nm2 and Nm2.1 were likely to form G-quadruplexes in the presence of alkali metal cations (K+ and Na+), which displayed excellent peroxidase activity exhibiting 19-fold higher catalytic efficiency than hemin alone. The selected aptamers could therefore be used as novel light-up fluorescent probes and DNAzymes by pairing with porphyrin compounds that have potential to construct sensors for various applications.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
Nm1 GGACGACCGACCGAAGGGAGGGATGGGTACATCTGTCGTCC      41 Porphyrin metalation
Nm2 AGCCCTGCTGCATTGCAACCAGGGGGTGGGCGTACCAGCAGGGCT      45 Porphyrin metalation
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra