PubMed ID: 18644842
Abstract:
Herein, we sought new or improved endoribonucleases based on catalytic DNA molecules known as deoxyribozymes. The current repertoire of RNA-cleaving deoxyribozymes can cleave nearly all of the 16 possible dinucleotide junctions with rates of at least 0.1/min, with the exception of pyrimidine–pyrimidine (pyr–pyr) junctions, which are cleaved 1–3 orders of magnitude slower. We conducted four separate in vitro selection experiments to target each pyr–pyr dinucleotide combination (i.e. CC, UC, CT and UT) within a chimeric RNA/DNA substrate. We used a library of DNA molecules containing only 20 random-sequence nucleotides, so that all possible sequence permutations could be sampled in each experiment. From a total of 245 clones, we identified 22 different sequence families, of which 21 represented novel deoxyribozyme motifs. The fastest deoxyribozymes exhibited kobs values (single-turnover, intermolecular format) of 0.12/min, 0.04/min, 0.13/min and 0.15/min against CC, UC, CT and UT junctions, respectively. These values represent a 6- to 8-fold improvement for CC and UC junctions, and a 1000- to 1600-fold improvement for CT and UT junctions, compared to the best rates reported previously under identical reaction conditions. The same deoxyribozymes exhibited ∼ 1000-fold lower activity against all RNA substrates, but could potentially be improved through further in vitro evolution and engineering.
DNAzymes linked to this article:
| Name | Isolated sequence | Length | Reaction | 
|---|---|---|---|
| S3 | AAATCCAGGGTTGGCCGACA | 20 | RNA cleavage | 
| S22 | CAGGTAGGGGTCCCGGTCA | 19 | RNA cleavage | 
| S23 | GGGTTCATCAAGGGGTATGG | 20 | RNA cleavage | 
| S9 | TACTGCTTTACTGGCGGCCA | 20 | RNA cleavage | 
| S13 | GGACAAGAGAAAGAGGTTGA | 20 | RNA cleavage | 
| S19 | TTGGGGGGGAGAGGTGGGGA | 20 | RNA cleavage | 
| S15 | AGTATATCAAGTGAATGGCA | 20 | RNA cleavage | 
| S10 | CGGGGTTTGGGATGAAGGGG | 20 | RNA cleavage | 
| S4 | TAGGGTGGGGTTAGAGTGGA | 20 | RNA cleavage | 
| S20 | TAGGGATAGGGGATAGGGGG | 20 | RNA cleavage | 
| S21 | GGGTGGATGGCGAGTGGCAG | 20 | RNA cleavage |