DNAmoreDB - A Database of Deoxyribozymes

Published on 2014 in Nucleic Acids Res. volume 42 issue 14.

PubMed ID: 25030901

DOI:10.1093/nar/gku592

Abstract:

Single-nucleotide polymorphisms, either inherited or due to spontaneous DNA damage, are associated with numerous diseases. Developing tools for site-specific nucleotide modification may one day provide a way to alter disease polymorphisms. Here, we describe the in vitro selection and characterization of a new deoxyribozyme called F-8, which catalyzes nucleotide excision specifically at thymidine. Cleavage by F-8 generates 3′- and 5′-phosphate ends recognized by DNA modifying enzymes, which repair the targeted deoxyribonucleotide while maintaining the integrity of the rest of the sequence. These results illustrate the potential of DNAzymes as tools for DNA manipulation.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
F-8 AGTGTTCCGTGGATGGAGCAATAGTCTCCCGGGTCCGTATGGATCGGCA      49 DNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra