DNAmoreDB - A Database of Deoxyribozymes

Published on 2019 in Scientific reports.

DOI:10.1038/s41598-019-44750-x

Abstract:

Deoxyribozymes capable of catalyzing sequence-specific RNA cleavage have found broad applications in biotechnology, DNA computing and environmental sensing. Among these, deoxyribozyme 8–17 is the most common small DNA motif capable of catalyzing RNA cleavage. However, the extent to which other DNA molecules with similar catalytic motifs exist remains elusive. Here we report a novel RNA-cleaving deoxyribozyme called 10–12opt that functions with an equally small catalytic motif and an unusually short binding arm. This deoxyribozyme contains a 14-nucleotide catalytic core that preferentially catalyzes RNA cleavage at UN dinucleotide junctions (kobs = 0.9 h−1 for UU cleavage). Surprisingly, the left binding arm contains only three nucleotides and forms two canonical base pairs with the RNA substrate. Mutational analysis reveals that a riboguanosine residue 3-nucleotide downstream of cleavage site must not form canonical base pairing for the optimal catalysis, and this nucleobase likely participates in catalysis with its carbonyl O6 atom. Furthermore, we demonstrate that deoxyribozyme 10–12opt can be utilized to cleave certain microRNA sequences which are not preferentially cleaved by 8–17. Together, these results suggest that this novel RNA-cleaving deoxyribozyme forms a distinct catalytic structure than 8–17 and that sequence space may contain additional examples of DNA molecules that can cleave RNA at site-specific locations.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
10-12 TGTTTCTCGCTTTGCTGGATGTACTTTT      28 RNA cleavage
10-12opt CATTTCTCGCTTTGCTGGATGTTACTTTT      29 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra