Abstract:
Deoxyribozyme and aptamer selections are typically conducted in aqueous buffer solutions. Using nonaqueous cosolvents in selection experiments will help expand the activity of deoxyribozymes with non‐oligonucleotide substrates and will allow identification of new aptamers for nonprotein targets. We undertook in vitro selections utilizing a small amount of methanol in the reaction to keep the herbicides alachlor and atrazine in solution with the goal of identifying deoxyribozymes that require these herbicides for activity. The resulting deoxyribozymes successfully catalyze RNA ligation, but do not require alachlor or atrazine. Surprisingly, some of these deoxyribozymes displayed better catalytic activity in the presence of methanol over just aqueous buffer. We investigated several organic cosolvents to see if this enhancement was limited to methanol and found that other cosolvents, including ethanol, DMSO, and DMF, supported activity; in some cases, greater enhancement was observed. On the basis of these results, we tested two other previously identified RNA‐ligating deoxyribozymes to assess their tolerance of cosolvents and determined that different deoxyribozymes showed different responses to the cosolvents. Our results demonstrate that deoxyribozymes can tolerate and, in some cases, display enhanced activity in alternative solvent conditions. These findings will facilitate the development of responsive deoxyribozyme systems utilizing components with limited water solubility.
DNAzymes linked to this article:
| Name | Isolated sequence | Length | Reaction | 
|---|---|---|---|
| 9Q1 | GGAGACAGGTTCCGGATGCATG | 22 | RNA ligation | 
| 9Q2 | GGAGATAGGTTCCAGCTGATTG | 22 | RNA ligation | 
| 9Q5 | GGACCGATGGAGTGAACTATGC | 22 | RNA ligation | 
| 9Q9 | ACGGACAGTTTCCGGAGCCGTG | 22 | RNA ligation | 
| 9R2a | GGTACGGGGCGTGCGGAGGCAC | 22 | RNA ligation | 
| 9R2b | GGTTCGGGGTATGCGGAGGCAT | 22 | RNA ligation | 
| 9R4a | GGACCGATGGAGTGAACTATGC | 22 | RNA ligation | 
| 9R6 | GGACCATGTTGGAGCGGCCCAG | 22 | RNA ligation | 
| 9R7 | GGACCATGGGGGAGCGGCCCGC | 22 | RNA ligation | 
| 9R16b | GGAGGATCGGACAGCGTTATCG | 22 | RNA ligation | 
| 9R20 | GGAGCGACACACAGACCTGTTC | 22 | RNA ligation | 
| 10Q7b | GGAGGATCGTACAGCGTTATCG | 22 | RNA ligation |