PubMed ID: 22042295
Abstract:
During in vitro selection for DNA-catalyzed lysine reactivity, we identified a deoxyribozyme that instead catalyzes nucleophilic attack of a phosphoramidate functional group at a 5′-triphosphate-RNA, forming an unusual pyrophosphoramidate (N–PV–O–PV) linkage. This finding highlights the relatively poor nucleophilicity of nitrogen using nucleic acid catalysts, indicating a major challenge for future experimental investigation.
DNAzymes linked to this article:
| Name | Isolated sequence | Length | Reaction | 
|---|---|---|---|
| 13LS3 | CAACATAAGGGAGGAGCAAATGAAAAATGTCAGGCGCAGTGAGTTTACGG | 50 | Covalent Modification of Amino Acid Side Chains |