DNAmoreDB - A Database of Deoxyribozymes

Published on 2014 in Chembiochem volume 15 issue 13.

PubMed ID: 25056930

DOI:10.1002/cbic.201402255

Abstract:

We report DNA catalysts (deoxyribozymes) that join tyrosine‐containing peptides to RNA and DNA in one step and without requiring protecting groups on either the peptide or the nucleic acid. Our previous efforts towards this goal required tethering the peptide to a DNA anchor oligonucleotide. Here, we established direct in vitro selection for deoxyribozymes that use untethered, free peptide substrates. This approach enables imposition of selection pressure via reduced peptide concentration and leads to preparatively useful lower apparent K m values of ∼100 μM peptide. Use of phosphorimidazolide (Imp) rather than triphosphate as the electrophile enables reactivity of either terminus (5′ or 3′) of both RNA and DNA. Our findings establish a generalizable means of joining unprotected peptide to nucleic acid in one step by using DNA catalysts identified by in vitro selection.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
8XJ105 GGGAGATGTCTCTCAGACGGAAACTTTCAGTACGGAATGG      40 Covalent Modification of Amino Acid Side Chains
10XK22 ACGATTTGAAGACTAAGTGGCTAGGGAGAAGTGAAACTCG      40 Covalent Modification of Amino Acid Side Chains
10XK35 ACGACTTGAAGATTAAGTGGCTCGGGTAATTTTTAGGTTA      40 Covalent Modification of Amino Acid Side Chains
11EM103 GTCGCCAGTCTCTGCTGCCTTGGTCATCAACCTTTCTGTC      40 Covalent Modification of Amino Acid Side Chains
11EP101 TGTGGGCCGTAAATCGCTTGCGGTGCTTTTTGGATGGGGT      40 Covalent Modification of Amino Acid Side Chains
11EP103 AGGTTGGGGGCGTAGTTGCTTTTGGGCGAATATGCTTGGC      40 Covalent Modification of Amino Acid Side Chains
11EP104 GGGAGTAGGGCCTGGGGCACTTGCGGCCCGTGAGACAGCA      40 Covalent Modification of Amino Acid Side Chains
11EP111 GGAGTCCTGTTTGAGTCGGCTATCCCGTTAATGGCGGGTA      40 Covalent Modification of Amino Acid Side Chains
11EP119 GGCTGTTGGCTCATCATATTATGATTGAGTTCGATGTCGG      40 Covalent Modification of Amino Acid Side Chains
11EP126 AGGTTGGGGGCGTTACTGCTTAATGTGATTCAATTGGCAT      40 Covalent Modification of Amino Acid Side Chains
11EP125 TCGGGGAATCGTGGGTGGCCCAAATGTGTTAATGAAGAAG      40 Covalent Modification of Amino Acid Side Chains
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra