DNAmoreDB - A Database of Deoxyribozymes

Published on 2014 in Angew. Chem. Int. Ed. Engl. volume 53 issue 34.

PubMed ID: 24981820

DOI:10.1002/anie.201404622

Abstract:

Catalyzing the covalent modification of aliphatic amino groups, such as the lysine (Lys) side chain, by nucleic acids has been challenging to achieve. Such catalysis will be valuable, for example, for the practical preparation of Lys‐modified proteins. We previously reported the DNA‐catalyzed modification of the tyrosine and serine hydroxy side chains, but Lys modification has been elusive. Herein, we show that increasing the reactivity of the electrophilic reaction partner by using 5′‐phosphorimidazolide (5′‐Imp) rather than 5′‐triphosphate (5′‐ppp) enables the DNA‐catalyzed modification of Lys in a DNA‐anchored peptide substrate. The DNA‐catalyzed reaction of Lys with 5′‐Imp is observed in an architecture in which the nucleophile and electrophile are not preorganized. In contrast, previous efforts showed that catalysis was not observed when Lys and 5′‐ppp were used in a preorganized arrangement. Therefore, substrate reactivity is more important than preorganization in this context. These findings will assist ongoing efforts to identify DNA catalysts for reactions of protein substrates at lysine side chains.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
8DW103 ACGGGGAACGGTATTAGGGAGTACTTGGAGAGCGCGTAGC      40 Covalent Modification of Amino Acid Side Chains
8DW112 CAAGGGGAACGAGGTTGTGAGAAGTAAGGGCGTGAGTAGC      40 Covalent Modification of Amino Acid Side Chains
8DW113 CCAGACCGCCAATTTAAAAGGGGCTTCTGGTGCTCGGGGG      40 Covalent Modification of Amino Acid Side Chains
8DW115 CCGGCGAAATCTACTACGGGTATAACGAGATGCGGACACG      40 Covalent Modification of Amino Acid Side Chains
8DW118 ACGGGGAACGTATGTATAGGAAGAAGCAGACGCGCGTAGC      40 Covalent Modification of Amino Acid Side Chains
8DW120 AGGGGAACGGAGAGAAACGAATAGTACGCGAGTGCGTAGC      40 Covalent Modification of Amino Acid Side Chains
8DW134 ACGGGGAACGAAAGGTGTACTTAAGATGTACGTGCGTAGC      40 Covalent Modification of Amino Acid Side Chains
7DX107 AGCAGCAATATGTCGCGGTATAGAGAGGATTGACTTGCGT      40 Covalent Modification of Amino Acid Side Chains
7DX108 AGGGGCGGAAACAGATAGAACGAGAGAGTGCGTCCCCGTA      40 Covalent Modification of Amino Acid Side Chains
7DX110 AGTGGTGCGCGTCACCCAACGCCAAAAGCGCTGTAACATA      40 Covalent Modification of Amino Acid Side Chains
7DX111 ATAGTGAGTCGTGTGTGACGCAAAAATTCGGATTCGAAAG      40 Covalent Modification of Amino Acid Side Chains
7DX112 AGAAACTGGGACACCGACGCCGAAGATCCACTAGAACATA      40 Covalent Modification of Amino Acid Side Chains
7DX114 AGGGCAGTGAAGGACAAGTGTCAAGAGCCTGGTGGCCCGT      40 Covalent Modification of Amino Acid Side Chains
7DX124 ACGGGAAGCGACGAAGGCTTCAAGAAGGGACTAGGACATA      40 Covalent Modification of Amino Acid Side Chains
9DT105 GTGCAGGATAGCACTGGGATCCGGTACGCCTCGGAGGGTT      40 Covalent Modification of Amino Acid Side Chains
14DV103 AGCGAGCGGCATGATGTCGAACATCGATCATTATGTGTGA      40 Covalent Modification of Amino Acid Side Chains
14DV104 AGCGAGCGACGTAGCGTGTTAAACACAACCCTACGTGTGA      40 Covalent Modification of Amino Acid Side Chains
14DV111 AGCGAGCGACACCGGCCAGCAATCGGAAGATGGTGTGTGA      40 Covalent Modification of Amino Acid Side Chains
14DV117 AGCGAGCGACGGGAGATCATTTTACATGATAAACGTGTGA      40 Covalent Modification of Amino Acid Side Chains
14DV131 AGCGAGCGGAACGTGCCAGCCGTCGTAGGGACGTTCGTGA      40 Covalent Modification of Amino Acid Side Chains
14DV108 AGCGAGCGGCGGAGTTGGATGATTTACCAATAACGCGTGA      40 Covalent Modification of Amino Acid Side Chains
9DT114 TAGCTGTCTAGGACCTATCGTACTGAGAATCATTCCAAAG      40 Covalent Modification of Amino Acid Side Chains
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra