DNAmoreDB - A Database of Deoxyribozymes

Published on 2012 in Chembiochem volume 13 issue 5.

PubMed ID: 22315198

DOI:10.1002/cbic.201200048

Abstract:

Hold your P's: Phosphorylated tyrosine and serine residues in peptides have been modified selectively by DNA catalysts (see graphic). These deoxyribozymes catalyze covalent attachment of an RNA tag to a range of peptide sequences, thus a proof of principle for a new approach to phosphopeptide analysis is established.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
8VM1 GACTGCGGGAGCGGTGAGCGGGTAGGTCTACATGAGGGCT      40 Covalent Modification of Phosphorylated Amino Acid Side Chains
8VP1 GGACACGATGAGTGACTAAGTGGAATGAGGAAAGCACGAG      40 Covalent Modification of Phosphorylated Amino Acid Side Chains
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra