DNAmoreDB - A Database of Deoxyribozymes

Published on 2016 in ChemistryOpen volume 6 issue 1.

DOI:10.1002/open.201600141

Abstract:

Here, we describe the characterization of new RNA‐cleaving DNAzymes that showed the highest catalytic efficiency at pH 4.0 to 4.5, and were completely inactive at pH values higher than 5.0. Importantly, these DNAzymes did not require any divalent metal ion cofactors for catalysis. This clearly suggests that protonated nucleic bases are involved in the folding of the DNAzymes into catalytically active structures and/or in the cleavage mechanism. The trans‐acting DNAzyme variants were also catalytically active. Mutational analysis revealed a conservative character of the DNAzyme catalytic core that underpins the high structural requirements of the cleavage mechanism. A significant advantage of the described DNAzymes is that they are inactive at pH values close to physiological pH and under a wide range of conditions in the presence of monovalent and divalent metal ions. These pH‐dependent DNAzymes could be used as molecular cassettes in biotechnology or nanotechnology, in molecular processes that consist of several steps. The results expand the repertoire of DNAzymes that are active under nonphysiological conditions and shed new light on the possible mechanisms of catalysis.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
Dz22_group1 CAACCCATTATCGACATTCTCTC      23 RNA cleavage
Dz24_group2 GTCCCAACCCCAAACCCTTCTCA      23 RNA cleavage
Dz40_group3 TACCCAACCCCAAATCCTTCTCC      23 RNA cleavage
Dz15_group4 TTACAAACCCCAAACCTTCTCTT      23 RNA cleavage
Dz42_unclassified CCCAACCCCAAATCCTTCTCTCG      23 RNA cleavage
Dz6_group1 CTACCCTCAAGCGACTTCTCTCG      23 RNA cleavage
Dz7_group1 CTACCCTCAAGCGACTTCTCTCG      23 RNA cleavage
Dz16_group1 CTACCCTCAAGCGACTTCTCTCG      23 RNA cleavage
Dz39_group1 CTACCCTCAAGCGACTTCTCTCG      23 RNA cleavage
Dz60_group1 CTACCCTCAAGCGACTTCTCTCC      23 RNA cleavage
Dz52_group1 TTACCCTTAATCGACTTTCTCTT      23 RNA cleavage
Dz2_group1 CAACCCTTTATCGACATTCTCTC      23 RNA cleavage
Dz18_group2 GTCCCAACCCCAAATCCTTCTCC      23 RNA cleavage
Dz43_group2 GTCCCAACCGCAAACCCTTCTCT      23 RNA cleavage
Dz29_group3 TACCCAACCCCAAATCCTTCTCC      23 RNA cleavage
Dz20_group3 TACCCAACCCCAAATCCTTCTCC      23 RNA cleavage
Dz13_group3 TACCCAACCCCAAATCCTTCTCC      23 RNA cleavage
Dz12_group3 TACCCAACCCCAAACCTTTCTTT      23 RNA cleavage
Dz30_group4 TACCCAACCCCAAACCTTCTCTT      23 RNA cleavage
Dz38_group4 TTACAAACCCCAAACCTTCTCTT      23 RNA cleavage
Dz23_group4 TTACAAACCCCAAACCTTCTCTT      23 RNA cleavage
Dz27_group1 CTACCCTCAAGCGACTTCTCTCG      23 RNA cleavage
Dz49_group1 CTACCCTCAAGCGACTTCTCTCG      23 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra