DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
DNA cleavage Group 1 - H2O


S: CTACCTTTATGCGTATCGAAGGAGGCTTTCGgga
hydrolyzed DNA Zn2+
Eu3+
DNA phosphodiester N 40
 Buffer conditions
70 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM ZnCl2, 10 µM EuCl3
 Yield (%) kcat/ kobs
79 kobs = 1.46 h-1
 Catalytic region of the DNAzyme
CCCCCGCAAAGAGAAGCAAGGGGGACCGCTTTGAATACGG

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2012 V Dokukin S K Silverman Lanthanide ions as required cofactors for DNA catalysts None 10.1039/C2SC01067D DNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra