DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
Covalent Modification of Phosphorylated Amino Acid Side Chains Group 1 - Phosphoserine


L: DNA-anchored AAAXAA hexapeptide
X: X = phosphoserine (SP)
Dehydroalanine Mn2+
Mg2+
Zn2+
N 40
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl
 Yield (%) kcat/ kobs
80 kobs = 0.28 h-1
 Catalytic region of the DNAzyme
ACAGGTGGCGGATGTAGTTTACCCGTTTTCTGTAGAGCC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2015 J Chandrasekar S K Silverman Phosphoserine Lyase Deoxyribozymes: DNA-Catalyzed Formation of Dehydroalanine Residues in Peptides. 26200899 10.1021/jacs.5b06308 Covalent Modification of Phosphorylated Amino Acid Side Chains

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra