| Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | Tyrosine Phosphorylation |
Group 1 - Tyrosine's hydroxyl Group 2 - ATP |
L: DNA-anchored CAAYAA hexapeptide R: ATP |
Phosphotyrosine |
Mn2+ Mg2+ Zn2+ |
N 40 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
| Yield (%) | kcat/ kobs |
|---|---|
| 50-60 | kobs = 0.21 h-1 |
| Catalytic region of the DNAzyme |
|---|
| TGAGCCCTTGCGAGAGACATGGGTCAGGACGGACAGAGGG |
| Notes |
|---|
| 14JS101 is a modular tyrosine kinase deoxyribozyme, in which the ATP aptamer domain binds the small-molecule ATP substrate and the initially random (N40) region is responsible for catalysis. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2014 | V Dokukin | S K Silverman | A modular tyrosine kinase deoxyribozyme with discrete aptamer and catalyst domains. | 25000337 | 10.1039/c4cc04253k | Tyrosine Phosphorylation |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2012 | A Sachdeva | S K Silverman | Covalent tagging of phosphorylated peptides by phosphate-specific deoxyribozymes. | 22315198 | 10.1002/cbic.201200048 |
Covalent Modification of Phosphorylated Amino Acid Side Chains |