Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | Tyrosine Phosphorylation |
Group 1 - Tyrosine's hydroxyl Group 2 - 5'-triphosphate |
L: DNA-anchored CAAYAA hexapeptide R: 5′-triphosphorylated RNA oligonucleotide |
Phosphotyrosine |
Mn2+ Mg2+ Zn2+ |
N 30 |
---|
Buffer conditions |
---|
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
Yield (%) | kcat/ kobs |
---|---|
30 | kobs = 0.26 h-1 |
Catalytic region of the DNAzyme |
---|
GACGGCACGAATCGACCATAGGGCAAAAGT |
Notes |
---|
Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2013 | S M Walsh | S K Silverman | DNA catalysts with tyrosine kinase activity. | 24066831 | 10.1021/ja407586u | Tyrosine Phosphorylation |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2015 | S M Walsh | S K Silverman | Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes. | 26407964 | 10.1007/s00239-015-9699-3 |
Tyrosine Phosphorylation |