DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
Tyrosine Phosphorylation Group 1 - Tyrosine's hydroxyl

Group 2 - 5'-triphosphate

L: DNA-anchored CAAYAA hexapeptide
R: 5′-triphosphorylated RNA oligonucleotide
Phosphotyrosine Mn2+
Mg2+
Zn2+
N 50
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl
 Yield (%) kcat/ kobs
70 kobs = 0.27 h-1
 Catalytic region of the DNAzyme
GGACCGTCTCGTTAGGAAGATTACGACGCCTTCCTCATGGGCAAGCCGAT
Notes
Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2013 S M Walsh S K Silverman DNA catalysts with tyrosine kinase activity. 24066831 10.1021/ja407586u Tyrosine Phosphorylation

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2015 S M Walsh S K Silverman Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes. 26407964 10.1007/s00239-015-9699-3 Tyrosine Phosphorylation
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra