Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|---|
Amide hydrolysis |
Group 1 - H2O |
S: *Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms. |
Carboxylic acid |
Mg2+ Zn2+ |
C-N bond | N 40 |
Buffer conditions |
---|
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
Yield (%) | kcat/ kobs |
---|---|
64 | kobs = 0.11 h-1 |
Catalytic region of the DNAzyme |
---|
AGAGCGGGACTACGCAGTCACGCGAATCGCTAGTACGTGG |
Notes |
---|
* The amide substrate was prepared by solution-phase coupling of a 3'-CO<sub>2</sub>H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (<sup>Am</sup>dU). |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | C Zhou | S K Silverman | DNA-Catalyzed Amide Hydrolysis. | 26854515 | 10.1021/jacs.5b12647 | Amide hydrolysis |