DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
DNA phosphorylation Group 1 - DNA 3'-OH

Group 2 - 5'-triphosphate

L: DNA oligonucleotide
R: 5′-triphosphorylated RNA oligonucleotide
3'-phosphorylated DNA * Mn2+
N 40
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl
 Catalytic region of the DNAzyme
CACGCAAGGGAACGAAGGATTAATCGGTCACCACAATCCG
Notes
Seems to form a product that is missing two nucleotides from the DNA substrate's 3'-terminus and bears a 3'-phosphate. See supporting information of the publication for further details.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 A J Camden S K Silverman DNA Oligonucleotide 3'-Phosphorylation by a DNA Enzyme. 27063020 10.1021/acs.biochem.6b00151 DNA phosphorylation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra