Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | DNA phosphorylation |
Group 1 - DNA 3'-OH Group 2 - 5'-triphosphate |
L: DNA oligonucleotide R: 5′-triphosphorylated RNA oligonucleotide |
3'-phosphorylated DNA * |
Mn2+ |
N 40 |
---|
Buffer conditions |
---|
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
Catalytic region of the DNAzyme |
---|
CACGCAACAATACCAGGAAGCCATCCGTGATCAAGTTGTC |
Notes |
---|
Seems to form a product that is missing two nucleotides from the DNA substrate's 3'-terminus and bears a 3'-phosphate. See supporting information of the publication for further details. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | A J Camden | S K Silverman | DNA Oligonucleotide 3'-Phosphorylation by a DNA Enzyme. | 27063020 | 10.1021/acs.biochem.6b00151 | DNA phosphorylation |