DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
Glycosylation Group 1 - DNA 3'-OH

Group 2 - Aryl glycoside

L: DNA oligonucleotide
R: 2-chloro-4-nitrophenyl β-D-Glc conjugated to a 5′-NH2-modified DNA oligonucleotide
3'-glycosylated DNA Mn2+
Zn2+
N 40
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl
 Catalytic region of the DNAzyme
GCCATACTGAAATGCGCTTACTGAGAAAGACGGGCGTGAA
Notes
Reselected from 11GV112.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 A R Hesser S K Silverman DNA-catalyzed glycosylation using aryl glycoside donors. 27355482 10.1039/c6cc04329a Glycosylation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra