Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | Glycosylation |
Group 1 - DNA 3'-OH Group 2 - Aryl glycoside |
L: DNA oligonucleotide R: 2-chloro-4-nitrophenyl β-D-Glc conjugated to a 5′-NH2-modified DNA oligonucleotide |
3'-glycosylated DNA |
Mn2+ Zn2+ |
N 40 |
---|
Buffer conditions |
---|
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
Catalytic region of the DNAzyme |
---|
GCCAAACATAAATGCGCTTACTGAGAAAAACGGGCGTGAA |
Notes |
---|
Reselected from 11GV112. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | A R Hesser | S K Silverman | DNA-catalyzed glycosylation using aryl glycoside donors. | 27355482 | 10.1039/c6cc04329a | Glycosylation |