| Reaction | Reacting groups | Substrates | Metal ion | Seq description | Reductive amination |
Group 1 - Aldehyde on the capture oligonucleotide Group 2 - N2-amine of the guanosine nucleobase in position 1 of the RNA substrate |
L: NaIO4-oxidized capture oligonucleotide R: 5'-mono or triphosphate RNA substrate complementary to the DNAzyme arm |
Ni2+ NaCNBH3 NaIO4 |
N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl |
| Catalytic region of the DNAzyme |
|---|
| AAGGGGTAGTGCCAAACGTACGAAGGCTTCATTACCGACC |
| Notes |
|---|
| Not studied in detail. This selection originally intended to isolate DNAzymes capable of modifying free peptide substrates. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2011 | O Y Wong | S K Silverman | DNA-catalyzed reductive amination. | 21994131 | 10.1002/anie.201104976 | Reductive amination |