Reaction | Reacting groups | Substrates | Metal ion | Seq description |
---|---|---|---|---|
Reductive amination |
Group 1 - Aldehyde on the capture oligonucleotide Group 2 - N2-amine of the guanosine nucleobase in position 1 of the RNA substrate |
L: NaIO4-oxidized capture oligonucleotide R: 5'-mono or triphosphate RNA substrate complementary to the DNAzyme arm |
Ni2+ NaCNBH3 NaIO4 |
N 40 |
Buffer conditions |
---|
50 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl |
Yield (%) | kcat/ kobs |
---|---|
30-40 | kobs = 0.14 h-1 |
Catalytic region of the DNAzyme |
---|
AAGGGGTAGTGCTAAACGTGAAGATGGTTTGGGTAATCTC |
Notes |
---|
This selection originally intended to isolate DNAzymes capable of modifying free peptide substrates. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2011 | O Y Wong | S K Silverman | DNA-catalyzed reductive amination. | 21994131 | 10.1002/anie.201104976 | Reductive amination |