Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | DNA cleavage |
Group 1 - H2O |
S: AAAGTCTCATGTACTTATATGTTCTAGCGCgga |
hydrolyzed DNA |
Mn2+ Zn2+ |
DNA phosphodiester | N 40 |
---|
Buffer conditions |
---|
70 mM HEPES (Varying pH: 7.2, 7.5 or 7.8), 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl |
Catalytic region of the DNAzyme |
---|
CGCCAGATAAGTGGGAGCCTTTGCTAAAGTTGTCCCTCAA |
Notes |
---|
Partially randomized catalytic region based on 10MD5 sequence |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2010 | Y Xiao | S K Silverman | Functional compromises among pH tolerance, site specificity, and sequence tolerance for a DNA-hydrolyzing deoxyribozyme. | 20923239 | 10.1021/bi1013672 | DNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2011 | Y Xiao | S K Silverman | Merely two mutations switch a DNA-hydrolyzing deoxyribozyme from heterobimetallic (Zn2+/Mn2+) to monometallic (Zn2+-only) behavior. | 21125108 | 10.1039/c0cc04575f |
DNA cleavage |