DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
DNA cleavage Group 1 - H2O


S: AAAGTCTCATGTACTTATATGTTCTAGCGCgga
hydrolyzed DNA Mn2+
Zn2+
DNA phosphodiester N 40
 Buffer conditions
70 mM HEPES (Varying pH: 7.2, 7.5 or 7.8), 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl
 Catalytic region of the DNAzyme
CGATAGATAAGTGGGGGCCTTTGCTGTAGCTGTCCCTCGA
Notes
Partially randomized catalytic region based on 10MD5 sequence

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2010 Y Xiao S K Silverman Functional compromises among pH tolerance, site specificity, and sequence tolerance for a DNA-hydrolyzing deoxyribozyme. 20923239 10.1021/bi1013672 DNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2011 Y Xiao S K Silverman Merely two mutations switch a DNA-hydrolyzing deoxyribozyme from heterobimetallic (Zn2+/Mn2+) to monometallic (Zn2+-only) behavior. 21125108 10.1039/c0cc04575f DNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra