Reaction | Substrates | Product | Metal ion | Linkage | Seq description |
---|---|---|---|---|---|
DNA cleavage |
S: GAATTCTAATACGACTCACTATAGGAAGAGATGGCGAC-N50-GGTTGGTGTGGTTG |
* |
metal ion dependency not reported |
DNA phosphodiester | N 50 |
Buffer conditions |
---|
50 mM HEPES pH 7.0, 0.5M NaCI, 0.5M KCI, 10 µM CuCl2, 10 µM ascorbate |
Catalytic region of the DNAzyme |
---|
GTATAGTGATCTCGGGTCTCTGTCTATGAAGAACTGTAGCCATAAT |
Notes |
---|
*Different cleavage products. The G8 in vitro selection pool was Cu<sup>2+</sup> dependent |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
1996 | N Carmi | R R Breaker | In vitro selection of self-cleaving DNAs. | 9000012 | 10.1016/s1074-5521(96)90170-2 | DNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
1998 | N Carmi | R R Breaker | Cleaving DNA with DNA. | 9482868 | 10.1073/pnas.95.5.2233 |
DNA cleavage |
2001 | N Carmi | R R Breaker | Characterization of a DNA-cleaving deoxyribozyme. | 11557347 | 10.1016/S0968-0896(01)00035-9 |
DNA cleavage |