DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Substrates Product  Metal ion Linkage  Seq description
DNA cleavage S: GAATTCTAATACGACTCACTATAGGAAGAGATGGCGAC-N50-GGTTGGTGTGGTTG
* metal ion dependency not reported
DNA phosphodiester N 50
 Buffer conditions
50 mM HEPES pH 7.0, 0.5M NaCI, 0.5M KCI, 10 µM CuCl2, 10 µM ascorbate
 Catalytic region of the DNAzyme
AGAGCTGTGGATCTGGAGCAAGGAAATCTCGGTAGGCGGGTTTACTAGAA
Notes
*Different cleavage products. The G8 in vitro selection pool was Cu<sup>2+</sup> dependent

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1996 N Carmi R R Breaker In vitro selection of self-cleaving DNAs. 9000012 10.1016/s1074-5521(96)90170-2 DNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1998 N Carmi R R Breaker Cleaving DNA with DNA. 9482868 10.1073/pnas.95.5.2233 DNA cleavage
2001 N Carmi R R Breaker Characterization of a DNA-cleaving deoxyribozyme. 11557347 10.1016/S0968-0896(01)00035-9 DNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra