DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
DNA cleavage Group 1 - H2O


S: TAATACGACTCACTATTAGGAAGAGATGGCGACgga
hydrolyzed DNA Mn2+
Zn2+
DNA phosphodiester N 40
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2 and 150 mM NaCl
 Yield (%) kcat/ kobs
50-60 kobs = 0.13 h-1
 Catalytic region of the DNAzyme
CCCACCTCTGCCGCTGAGGTCCGTTAAATGTACTATCGCG
Notes
Both Zn<sup>2+</sup> and Mn<sup>2+</sup> were included during all selections and activity assays of the DNAzymes reported in this publication, the detailed metal ion and pH dependencies for individual DNAzymes were not assessed.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2012 Y Xiao S K Silverman Establishing broad generality of DNA catalysts for site-specific hydrolysis of single-stranded DNA. 22021383 10.1093/nar/gkr860 DNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2009 M Chandra S K Silverman DNA-catalyzed sequence-specific hydrolysis of DNA None 10.1038/nchembio.201 DNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra