Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | DNA cleavage |
Group 1 - H2O |
S: TAATACGACTCACTATTCGGAAGAGATGGCGACgga |
hydrolyzed DNA |
Mn2+ Zn2+ |
DNA phosphodiester | N 40 |
---|
Buffer conditions |
---|
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2 and 150 mM NaCl |
Yield (%) | kcat/ kobs |
---|---|
70-80 | kobs = 0.41 h-1 |
Catalytic region of the DNAzyme |
---|
TATGACACTTATTATAAATATGCTAGTAACGGATAGGTTG |
Notes |
---|
Both Zn<sup>2+</sup> and Mn<sup>2+</sup> were included during all selections and activity assays of the DNAzymes reported in this publication, the detailed metal ion and pH dependencies for individual DNAzymes were not assessed. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2012 | Y Xiao | S K Silverman | Establishing broad generality of DNA catalysts for site-specific hydrolysis of single-stranded DNA. | 22021383 | 10.1093/nar/gkr860 | DNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2009 | M Chandra | S K Silverman | DNA-catalyzed sequence-specific hydrolysis of DNA | None | 10.1038/nchembio.201 |
DNA cleavage |