DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
DNA cleavage Group 1 - H2O


S: *
hydrolyzed DNA Mn2+
Zn2+
DNA phosphodiester N 40
 Buffer conditions
70 mM Tris pH 7.5, 40 mM MgCl2, 20 mM MnCl2,1 mM ZnCl2, 150 mM NaCl
 Catalytic region of the DNAzyme
GGCCTCGTGCTGGGAGTGCGCGGCAAGACACTAACGCCGA
Notes
The selection aimed at the isolation of DNAzymes catalyzing the hydrolysis of amide bonds, available within the tripeptide substrate (the substrate was held between two DNA anchor oligonucleotides complementary to the DNAzyme's "binding arms"). However, the selection isolated DNAzymes that catalyzed the hydrolysis of phosphodiester bonds at four different sites.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2009 M Chandra S K Silverman DNA-catalyzed sequence-specific hydrolysis of DNA None 10.1038/nchembio.201 DNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2012 Y Xiao S K Silverman Establishing broad generality of DNA catalysts for site-specific hydrolysis of single-stranded DNA. 22021383 10.1093/nar/gkr860 DNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra