Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | DNA cleavage |
Group 1 - H2O |
S: * |
hydrolyzed DNA |
metal ion dependency not reported |
DNA phosphodiester | N 40 |
---|
Buffer conditions |
---|
70 mM Tris pH 7.5, 40 mM MgCl2, 20 mM MnCl2,1 mM ZnCl2, 150 mM NaCl |
Catalytic region of the DNAzyme |
---|
AGTGCACACGTCAGTCTTTTGTGATATTTTCAGCGTATCA |
Notes |
---|
The selection aimed at the isolation of DNAzymes catalyzing the hydrolysis of amide bonds, available within the tripeptide substrate (the substrate was held between two DNA anchor oligonucleotides complementary to the DNAzyme's "binding arms"). However, the selection isolated DNAzymes that catalyzed the hydrolysis of phosphodiester bonds at four different sites. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2009 | M Chandra | S K Silverman | DNA-catalyzed sequence-specific hydrolysis of DNA | None | 10.1038/nchembio.201 | DNA cleavage |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2012 | Y Xiao | S K Silverman | Establishing broad generality of DNA catalysts for site-specific hydrolysis of single-stranded DNA. | 22021383 | 10.1093/nar/gkr860 |
DNA cleavage |