| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | Amide hydrolysis |
Group 1 - H2O |
S: Anilide (aromatic amide) |
Carboxylic acid |
Mn2+ Zn2+ |
C-N bond | N 30 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
| Catalytic region of the DNAzyme |
|---|
| ACAGGCCGGGAAAGGCGACAGCCTGGGTAA |
| Notes |
|---|
| The amide substrate is covalently attached to a DNA anchor oligonucleotide. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2013 | B M Brandsen | S K Silverman | DNA-catalyzed hydrolysis of esters and aromatic amides. | 24127695 | 10.1021/ja4077233 | Amide hydrolysis |