DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
Amide hydrolysis Group 1 - H2O


S: Anilide (aromatic amide)
Carboxylic acid Mn2+
Zn2+
C-N bond N 30
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl
 Catalytic region of the DNAzyme
ACGGGCCGGGAAGCATCTCGGATGCGGGTA
Notes
The amide substrate is covalently attached to a DNA anchor oligonucleotide.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2013 B M Brandsen S K Silverman DNA-catalyzed hydrolysis of esters and aromatic amides. 24127695 10.1021/ja4077233 Amide hydrolysis

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra