Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | Amide hydrolysis |
Group 1 - H2O |
S: Anilide (aromatic amide) |
Carboxylic acid |
Mn2+ Mg2+ Zn2+ |
C-N bond | N 40 |
---|
Buffer conditions |
---|
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
Catalytic region of the DNAzyme |
---|
ACAGGACGGGAAGCAACGAGCAAGACGAGGAAGCGGGTGC |
Notes |
---|
The AP1 selection is the a reselection of the 8ZC9 deoxyribozyme |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2013 | B M Brandsen | S K Silverman | DNA-catalyzed hydrolysis of esters and aromatic amides. | 24127695 | 10.1021/ja4077233 | Amide hydrolysis |