| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | Ester hydrolysis |
Group 1 - H2O |
S: Ester |
Carboxylic acid |
Mn2+ Mg2+ Zn2+ |
ester | N 40 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
| Yield (%) | kcat/ kobs |
|---|---|
| >80 | kobs = 0.51 h-1 |
| Catalytic region of the DNAzyme |
|---|
| GCCGATAAGCAAAGCATCAGGAGTACGAACAGGTCCAAAT |
| Notes |
|---|
| The ester substrate is covalently attached to a DNA anchor oligonucleotide. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2013 | B M Brandsen | S K Silverman | DNA-catalyzed hydrolysis of esters and aromatic amides. | 24127695 | 10.1021/ja4077233 | Ester hydrolysis |