DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
Dephosphorylation Group 1 - H2O

Group 2 - phosphate

X: YP = phosphotyrosine
S: AAAXAA
Dephosphorylated DNA-anchored hexapeptide Zn2+
phosphomonoester N 40
 Buffer conditions
70 mM Hepes pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl
 Catalytic region of the DNAzyme
AGCCTGAAGGAGTTGCCTTCATGGGGGTGTTACTCCCAAT
Notes
The substrate hexapeptide is connected to a DNA anchor oligonucleotide

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2013 J Chandrasekar S K Silverman Catalytic DNA with phosphatase activity. 23509279 10.1073/pnas.1221946110 Dephosphorylation

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2011 O Y Wong S K Silverman DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates. 21510668 10.1021/bi200585n Covalent Modification of Amino Acid Side Chains
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra