Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | Dephosphorylation |
Group 1 - H2O Group 2 - phosphate |
X: YP = phosphotyrosine S: AAAXAA |
Dephosphorylated DNA-anchored hexapeptide |
Zn2+ |
phosphomonoester | N 40 |
---|
Buffer conditions |
---|
70 mM Hepes pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
Catalytic region of the DNAzyme |
---|
AGCCTGAAGGAGTTGCCTTCATGGGGGTGTTACTCCCAAT |
Notes |
---|
The substrate hexapeptide is connected to a DNA anchor oligonucleotide |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2013 | J Chandrasekar | S K Silverman | Catalytic DNA with phosphatase activity. | 23509279 | 10.1073/pnas.1221946110 | Dephosphorylation |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2011 | O Y Wong | S K Silverman | DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates. | 21510668 | 10.1021/bi200585n |
Covalent Modification of Amino Acid Side Chains |