Reaction | Reacting groups | Substrates | Metal ion | Seq description |
---|---|---|---|---|
Copper-mediated Azide-Alkyne Cycloaddition (CuAAC) |
Group 1 - Alkyne Group 2 - Azide |
L: 5′-hexynyl-labeled pool during in vitro selection R: Azide-PEG3-biotin |
Cu2+ Cu+ |
N 40 |
Buffer conditions |
---|
50 mM HEPES pH 7.4, 300 mM NaCl, 50 mM KCl, 20 mM MgCl2, 2.5 mM Azide-PEG3-biotin, 5 μM CuSO4, 2.5 mM Sodium Ascorbate |
Catalytic region of the DNAzyme |
---|
GCTTAAATTAGGGCTATTTAGGTCTCAGTTCATCAGCAGA |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2020 | K Liu | D Sen | CLICK-17, a DNA enzyme that harnesses ultra-low concentrations of either Cu+ or Cu2+ to catalyze the azide-alkyne 'click' reaction in water. | 32520335 | 10.1093/nar/gkaa502 | Copper-mediated Azide-Alkyne Cycloaddition (CuAAC) |