DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates  Metal ion  Seq description
Copper-mediated Azide-Alkyne Cycloaddition (CuAAC) Group 1 - Alkyne

Group 2 - Azide

L: 5′-hexynyl-labeled pool during in vitro selection
R: Azide-PEG3-biotin
Cu2+
Cu+
N 40
 Buffer conditions
50 mM HEPES pH 7.4, 300 mM NaCl, 50 mM KCl, 20 mM MgCl2, 2.5 mM Azide-PEG3-biotin, 5 μM CuSO4, 2.5 mM Sodium Ascorbate
 Catalytic region of the DNAzyme
CCTGATTGCTACCACTCCCGCTGAATCTGTTGCCTCTTC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2020 K Liu D Sen CLICK-17, a DNA enzyme that harnesses ultra-low concentrations of either Cu+ or Cu2+ to catalyze the azide-alkyne 'click' reaction in water. 32520335 10.1093/nar/gkaa502 Copper-mediated Azide-Alkyne Cycloaddition (CuAAC)

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra