| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of G16 / G15 Group 2 - vicinal phosphate |
X: i6A S: AUAGACUGAAUGAAGGACUUCCGUAACU/ AUAGACUGAAUGAAGGXCUUCCGUAACU |
cleavage at G16 / G15 |
Mg2+ |
RNA phosphodiester | N 20 |
|---|
| Buffer conditions |
|---|
| 500 mM Tris-HCl, 1.5 M NaCl, 5mM MgCl2 |
| Yield (%) | kcat/ kobs |
|---|---|
| 82 and 51 for unmodified and i6A-modified RNA, respectively. | kobs = 0.018 min-1 and kobs = 0.0016 min-1 for unmodified and i6A-modified RNA, respectively. |
| Catalytic region of the DNAzyme |
|---|
| GGGTCTCCAGCCGGACGTTA |
| Notes |
|---|
| AC17 yields cleavage products with both unmodified and i6A-modified RNA substrates. For this reason, two substrates, as well as two different reaction products are indicated (for unmodified and modified substrates, respectively). |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2020 | A Liaqat | C Höbartner | N 6-isopentenyladenosine in RNA determines the cleavage site of endonuclease deoxyribozymes. | 32681686 | 10.1002/anie.202006218 | RNA cleavage |