DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of G15

Group 2 - vicinal phosphate

S: AUAGACUGAAUGAAGGACUUCCGUAACU
cleavage at G15 Mg2+
RNA phosphodiester N 20
 Buffer conditions
500 mM Tris-HCl, 1.5 M NaCl, 5mM MgCl2
 Yield (%) kcat/ kobs
74 kobs = 0.0066 min-1
 Catalytic region of the DNAzyme
TGGTCTCGCGGTTCCTGGTTA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2020 A Liaqat C Höbartner N 6-isopentenyladenosine in RNA determines the cleavage site of endonuclease deoxyribozymes. 32681686 10.1002/anie.202006218 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra