DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Substrates Product  Metal ion  Seq description
Thymine dimer repair X: T=T is a thymine dimer
S: AGGATCTACATGTAT=TGTGTGCGTACGAGTATATGG-N40-GTCTCAATCGGTCTGTATC
repaired sequences light
Serotonin
N 40
 Buffer conditions
20 mM Sodium phosphate pH 7.0, 40 mM NaCl, 10 μM Serotonin
 Catalytic region of the DNAzyme
AGCACAGTCGCAAGACGATATGCAGGAACTTGGACAGCCG
Notes
Self repair of the Thymine dimer located on the 5'-end of the DNA library (primer binding region).

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2009 R E Thorne D Sen A deoxyribozyme, Sero1C, uses light and serotonin to repair diverse pyrimidine dimers in DNA. 19281822 10.1016/j.jmb.2009.02.064 Thymine dimer repair

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2004 D J-F Chinnapen D Sen A deoxyribozyme that harnesses light to repair thymine dimers in DNA. 14691255 10.1073/pnas.0305943101 Thymine dimer repair
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra