| Reaction | Substrates | Product | Seq description | Porphyrin metalation |
S: mesoporphyrin IX (MPIX) |
Cu-MPIX | N 40 |
|---|
| Buffer conditions |
|---|
| 25 mM TrisOAc pH 7.5, 25 mM KCl, 0.5% (w/v) Triton X-100, 1% (v/v) DMSO |
| Catalytic region of the DNAzyme |
|---|
| AAAAGAATGCTCATCCTGGGGTAGGCATGAAGCGGGGCCG |
| Notes |
|---|
| The in vitro selection was conducted to isolate aptamers binding N-methyl mesoporphyrin IX (NMM). The reported buffer in this case is not the one used during the selection procedure, but instead, the one used to evaluate catalytic activity of the selected aptamers. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2013 | J Yang | M T Bowser | Capillary electrophoresis-SELEX selection of catalytic DNA aptamers for a small-molecule porphyrin target. | 23234289 | 10.1021/ac302721j | Porphyrin metalation |