| Reaction | Substrates | Product | Seq description | Porphyrin metalation |
S: mesoporphyrin IX (MPIX) |
Cu-MPIX | N * |
|---|
| Buffer conditions |
|---|
| 100 mM Tris pH 7.1, 225 mM KOAc, 5% DMSO, 0.5% Triton X-100 |
| Catalytic region of the DNAzyme |
|---|
| GAAGATCGTGGGTCATTGTGGGTGGGTGTGGCT |
| Notes |
|---|
| Derived from PS5.ST1, not characterized further. See PS5 (PS5.M). The reported buffer conditions were used in assays to determine the optimal sequence (derived from PS5.ST1) for catalysis. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 1997 | Y Li | D Sen | Toward an efficient DNAzyme. | 9154943 | 10.1021/bi962694n | Porphyrin metalation |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 1996 | Y Li | D Sen | A catalytic DNA for porphyrin metallation | None | 10.1038/nsb0996-743 |
Porphyrin metalation |