DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Substrates Product  Seq description
Porphyrin metalation S: mesoporphyrin IX (MPIX)
Cu-MPIX N *
 Buffer conditions
100 mM Tris pH 7.1, 225 mM KOAc, 5% DMSO, 0.5% Triton X-100
 Catalytic region of the DNAzyme
GTGTCGAAGATCGTGGGTCATTGTGGGTGGGTGTGGCT
Notes
Derived from PS5.ST1, not characterized further. See PS5 (PS5.M). The reported buffer conditions were used in assays to determine the optimal sequence (derived from PS5.ST1) for catalysis.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1997 Y Li D Sen Toward an efficient DNAzyme. 9154943 10.1021/bi962694n Porphyrin metalation

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1996 Y Li D Sen A catalytic DNA for porphyrin metallation None 10.1038/nsb0996-743 Porphyrin metalation
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra