| Reaction | Substrates | Product | Seq description | Porphyrin metalation |
S: protoporphyrin IX (PPIX)/ mesoporphyrin IX (MPIX) |
Cu-MPIX | N * |
|---|
| Buffer conditions |
|---|
| 100 mM Tris pH 7.1, 225 mM KOAc, 5% DMSO, 0.5% Triton X-100 |
| kcat/ kobs |
|---|
| kcat = 1.30 min-1 |
| Catalytic region of the DNAzyme |
|---|
| GTGGGTCATTGTGGGTGGGTGTGG |
| Notes |
|---|
| 24-nt-long sequence from within PS5.ST1. The reported buffer conditions were used in assays to determine the optimal sequence (derived from PS5.ST1) for catalysis. Further analyses were carried out on this DNAzyme, and optimized reaction conditions are reported in the publication. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 1997 | Y Li | D Sen | Toward an efficient DNAzyme. | 9154943 | 10.1021/bi962694n | Porphyrin metalation |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 1996 | Y Li | D Sen | A catalytic DNA for porphyrin metallation | None | 10.1038/nsb0996-743 |
Porphyrin metalation |