DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: CTGCAGAATTCTAATACGACTCACTATrAGGAAGAGATGGCGACATCTC-E-GTGACGGTAAGCTTGGCAC
specific cleavage at desired position RNA phosphodiester N 23
 Buffer conditions
HEPES 50 mM, pH 7.0, NaCl 100 mM, CdCl2
 Catalytic region of the DNAzyme
TACCCAACCCCAAATCCTTCTCC
Notes
Cleavage in cis. Substrate annotated as obtained by in vitro selection, i.e. constant region, catalytic cleavage site (rA), region randomized in the initial DNAzyme library , constant region.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 A Kasprowicz J Ciesiołka Characterization of Highly Efficient RNA‐Cleaving DNAzymes that Function at Acidic pH with No Divalent Metal‐Ion Cofactors None 10.1002/open.201600141 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra