Reaction | Reacting groups | Substrates | Product | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: CTGCAGAATTCTAATACGACTCACTATrAGGAAGAGGTGGCGACATCTC-E-GTGGCGGTAAGCTTGGCAC |
specific cleavage at desired position | RNA phosphodiester | N 23 |
---|
Buffer conditions |
---|
HEPES 50 mM, pH 7.0, NaCl 100 mM, CdCl2 |
Catalytic region of the DNAzyme |
---|
CTACCCTCAAGCGACTTCTCTCG |
Notes |
---|
Cleavage in cis. Substrate annotated as obtained by in vitro selection, i.e. constant region, catalytic cleavage site (rA), region randomized in the initial DNAzyme library , constant region. |
Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
---|---|---|---|---|---|---|
2016 | A Kasprowicz | J Ciesiołka | Characterization of Highly Efficient RNA‐Cleaving DNAzymes that Function at Acidic pH with No Divalent Metal‐Ion Cofactors | None | 10.1002/open.201600141 | RNA cleavage |