| Reaction | Reacting groups | Substrates | Product | Seq description | DNA capping |
Group 1 - DNA 5'-PO4-2 oxygen Group 2 - ATP |
S: GGAAGAATGGTAC-N70-AGCTGATCCTGATGG |
5',5'-AppDNA | N 70 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.0, 400 mM NaCl, 100 mM KCl, 10 mM MgCl2, 5 mM CaCl2, 1 mM MnCl2, and 50 µM CuCl2, 1mM ATP |
| Catalytic region of the DNAzyme |
|---|
| AATCTGGGAGTCGTTCCTGGGGTATTATGTCAGATGTTATGTAATAACGTAGTATACTGAACGCCCCC |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2000 | Y Li | R R Breaker | Capping DNA with DNA. | 10715132 | 10.1021/bi992710r | DNA capping |